Match the terms with the type of transposon B. IS A. retrotranspson abundant in humans A L1 8 DNA transposon first discovered EV AcDs C ONA transposon in bacteria F. Alu 0.ONA ransposon C Tn E Transposons in bacteria that can carry an antibiotic resistance gene G.V RNA intermediate F. retrotransposon D. transpososome G. retrotransposon related with schizophrenia

Q: II. Identify what the mRNA, tRNA and amino acid for the DNA bases below. DNA bases below can be…

A: The mRNA and amino acids sequences can be deduced by DNA sequence. The mRNA sequences are…

Q: Which of the following regions of the DNA is NOT transcribed by RNA polymerase? 1. -10/-35 promoter…

A: RNA polymerase is an enzyme that helps in the synthesis of RNA from the DNA template. This enzyme…

Q: Which of the following is FALSE about DNA methylation? O a. the base to be methylated is found in…

A: The CpG sites or CG sites are regions of DNA where a cytosine nucleotide is followed by the guanine…

Q: Can you please do question 9,10, and 11

A: Hey, since there are multiple questions posted, we are answering the first one. If you want any…

Q: A specific micro RNA is capable of destroying/degrade m-RNA after synthesis A. TRUE  B False

A: Introduction : The molecule RNA is crucial in translating the genetic code found in a cell's DNA…

Q: aminoacyl-tRNA

A: 43 D third position   The wobble position of a codon refers to the 3rd nucleotide in a…

Q: What kinds of nonstructural genes are never translated

A: What kinds of nonstructural genes are never translated?   Answer. (b) transfer RNA and ribosomal…

Q: The gene for the primase enzyme is mutated and is nonfunctional. What is the result of such a…

A: The process associated with the duplication of genetic material or DNA can be described as…

Q: The sigma subunit of bacterial RNA polymerase _____. a. binds to a bacterial gene’s promoter b. is…

A: DNA polymerase is an enzyme that catalyzes the formation of new DNA strands from existing DNA…

Q: In T4 phage, the initial transcription is carried out by_ Select one: O a. the DNA polymerase…

A: ANSWER;- d) the RNA polymerase encoded by the T4 phage genome. Explain;- T4 phage, the initial…

Q: QUESTION 3 DNA methylation O a. You cannot methylate DNA O b. Enhances O c. Represses O d. Represses…

A:

Q: 87) For a the viral proteins a. If the viral protein is made in the RER, it will go back to the…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Methylated cytosines

A: Answer:

Q: Missense mutations   a create premature stop codons   b cause no change in a gene product   c…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: 20. The image above reveals two bacterial cells in the process of A. cell lysis B. transduction C.…

A: In the image given for MCQ (20), the two bacterial cells are under the process of "Conjugation".…

Q: Match the eukaryotic polymerases and accessory proteins with the polymerases (or polymerase…

A: PCNA stands for proliferating cell nuclear antigen. In prokaryotes three different types of DNA…

Q: 17. NF1 protein ---- Ras signaling. a. activates b. inhibits 18. The deacetylation of the histones…

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…

Q: A normal strand of DNA reads: 5'-AGTCAA-3'. If a mutation occurs that alters that DNA sequence to…

A: A mutation is a permanent change in the DNA sequence of a gene or chromosome. It can occur as a…

Q: (select all correct answers) Which of the following mutant lambda phages can still go to lysogenic…

A: Option b is the right answer.

Q: What is the most likely consequence of a single base mismatch error made by RNA polymerase? A…

A: The central dogma of molecular biology is a theory, according to which, genetic information flows…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: Poliovirus contains a protein that possesses an NLS. A drug is developed that binds and hides this…

A: NLS or nuclear localization signal IA an amino acid sequence that tags a protein for import into the…

Q: Protein Z in the figure below depicts the activity of which bacterial Nucleoid Associated Protein…

A: The genetic material in bacteria is DNA. To fit the bacterial chromosome inside the tiny bacterial…

Q: Replication factor C Proliferating cell nuclear antigen Okazaki fragments DNA Ligase Operans Codon…

A: Introduction  Cell division is the process by which a single cell splits into two or more daughter…

Q: 4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA.…

A: 4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA.…

Q: For transcription of middle promoters in T4 phage, the anti-sigma factor, AsiA, will а. bind -10…

A: The bacteriophage T4 Alt gene product is a component of the phage head and, together with the phage…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.