Explain all options Which of the following is FALSE about DNA methylation?a.the base to be methylated is found in the pattern CpGO b. during DNA methylation a methyl group is added to a Cmethylated DNA is found in regions of the chromosome that are not actively transcribedO c.d. after DNA has been replicated methyl groups are added to all C's in the pattern CpG in the newly made strand of DNAe.all are CORRECTThe correct answer is: after DNA has been replicated methyl groups are added to all C's in the pattern CpG in the newly madestrand of DNAFinish review

The CpG sites or CG sites are regions of DNA where a cytosine nucleotide is followed by the guanine…

Which of the following is FALSE about DNA methylation? O a. the base to be methylated is found in the pattern CpG O b. during DNA methylation a methyl group is added to a C O c. methylated DNA is found in regions of the chromosome that are not actively transcribed d. after DNA has been replicated methyl groups are added to all C's in the pattern CpG in the newly made strand of DNA O e. all are CORRECT The correct answer is: after DNA has been replicated methyl groups are added to all C's in the pattern CpG in the newly made strand of DNA

Which of the following is FALSE about DNA methylation? O a. the base to be methylated is found in the pattern CpG O b. during DNA methylation a methyl group is added to a C O c. methylated DNA is found in regions of the chromosome that are not actively transcribed d. after DNA has been replicated methyl groups are added to all C's in the pattern CpG in the newly made strand of DNA O e. all are CORRECT The correct answer is: after DNA has been replicated methyl groups are added to all C's in the pattern CpG in the newly made strand of DNA

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 5RQ: The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA...

See similar textbooks

Similar questions

What does it mean to say thhat extension by DNA polymerase III proceed 5'---3'? A. The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. B. DNA polymerase adds nucleotides to a growing strand, moving in the 5' to 3' direction. C. DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. D. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA.
a. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chains
The mismatch DNA repair mechanism is based on the fact that: O a. O b. O C. O d. The parental DNA strand is recognized because it is structurally distorted. The parental DNA strand is methylated while daughter strand is not. The daughter DNA strand is recognized because it is structurally distorted. The daughter DNA strand is methylated while parental strand is not.
Match the following type of DNA repair mechanism with the most appropriate definition. Nucleotide excision repair Homologous recombination Base excision repair Nonhomologous end joining A. Repairs thymine dimers by removing a section of the strand B. Corrects damaged bases by removing only the base C. Repairs double strand breaks by joining the ends D. Repairs double strand breaks by copying second chromosome
During DNA replication, DNA methylation: please explain answer a. A and C b. B. marks the strand not cut in mismatch repair c. A and B d. A. marks the parental DNA strand e. C. marks the strand cut in mismatch repair
The following is a figure that depicts telomerase extending a telomere. -aaucccaauc ttag telomere The lagging strand template for DNA replication of this section of the chromosome is: a. Strand A Ob. Cannot be determined from the information given above O C. Not needed due to telomerase activity O d. Strand B O e. Strand C
Different DNA polymerases play distinct roles in DNA replication and repair in both prokaryotic and eukaryotic cells. All known DNA polymerases synthesize DNA only in by the addition of the dNTPs to a performed primer strand of DNA. A. positive direction B. 3' to 5' direction C. 5' to 3' direction D. negative direction
Which of the following statements is FALSE regarding the molecular mechanism for DNA polymerases? A. The active site contains 2 divalent metal ions B. A single stranded DNA template is required C. The enzyme can only attach a new deoxynucleotide to the 5’ end of a growing chain D. The 3’OH on the deoyxyribose ring attacks a phosphate of a dNTP to produce a new phosophodiester bond E. None of the above (all are true statements)
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
1. Cytosine deamination, in which cytosine is mutated to uracil, occurs spontaneously in DNA at a rate of 1 out of 107 cytosines in 24 hours. tofo NH₂ 'N cytosine deamination ----ဝိ NH spr a. If cytosine deamination occurs and DNA polymerase replicates the DNA with this altered base, what mutation would be introduced into DNA? b. Cytosine deamination is so common that DNA repair enzymes recognize uracil and replace it with cytosine. Given this information, why is it essential for DNA, the carrier of the genetic blueprint, to utilize thymine, not uracil, as a base?
a. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and the gel is stained with ethidium bromide. Draw a picture of the bands that will appear on the gel. b. If a mutation that alters EcoRI site 1 occurs in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? c. If mutations that alter EcoRI sites 1 and 2 occur in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? d. If 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one that you drew in part a? e. If 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one that you drew in part a?