In transcription, to which end of the elongating strand are nucleotides always added. 3' in prokaryotes and 5 in eukaryotes Depending on which side it started 5'in eukaryotes 3' in eukaryotes 5'

Q: What is Ammensalim?

A: Organisms living together in a community influence each other directly or indirectly under natural…

Q: When would you not use ice?

A: Cold application or cryotherapy. Cold causes constriction of blood vessels and leads to  Reduced…

Q: Helen is a 62-year-old smoker. Her physician has diagnosed her as having emphysema that has caused…

A: Respiratory system is a part of the body system that mainly deals with removal of carbon dioxide gas…

Q: Triglycerides are made of glycerol and _________

A: Triglycerides are the one of an important group of naturally occurring lipids which is otherwise…

Q: Why does hematoxylin stain cartilage?

A: Hematoxylin is the principle tissue stains used in histology. It is a complex of aluminium salt and…

Q: how did you detremine the ln(2)?

A: The concept of 'ln' is nothing but simple mathematics. We can simply type - 'ln 2' in a calculator…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: Toncity is the

A:

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.