2. Discuss an enzyme/enzymes that can use different mechanisms action depending environment. Explain. on the
Q: a. A tetrapeptide is abbreviated as PSQE. Write the name of the amino acid at the N-terminal end. b.…
A: An amino acid is a biomolecule with an amino group, a carboxyl group and a chemically diverse group…
Q: cells of the working tissue as HCO3 - in the blood
A: Transport of Respiratory Gases :
Q: What is the net charge on the amino acid cysteine at pH 8.0? (pKa values are α-carboxyl 2; α-amino…
A: The pKa values for cysteine's α-carboxyl group, side chain, and α-amino group are 2, 8, and 10,…
Q: Which of the following is true regarding the reaction catalyzed by the enzyme PEPCK? a) It produces…
A: The reaction catalyzed by the enzyme PEPCK (Phosphoenolpyruvate carboxykinase) is an important step…
Q: 15.3) In the previous problem, you drew the products for the phosphorylation of ADP reaction (shown…
A: Phosphorylation is the process of adding a phosphate group to a molecule, and in the case of ADP, it…
Q: What are the possivble oxidation product of catalase using H2O2 as the substrate? Explain in 1-3…
A: Catalase is an enzyme found in living organisms, including humans, that plays a crucial role in…
Q: Oxidative decarboxylations— involve loss of CO2 and the production of NADH. do not occur…
A: INTRODUCTION: Oxidation response where the carboxyl molecule is eliminated as carbon dioxide.…
Q: What is the thermodynamic driving force behind the formation of a peptide bond and how does it…
A: A dehydration reaction is a chemical reaction where the formation of a chemical bond involves the…
Q: Complex 4 of the electron transport chain pumps 4 protons for every 4 molecules of cytochrome C that…
A: Cytochrome C oxidase or Complex IV is a multi-subunit molecule. It takes electrons from cytochrome C…
Q: One hundred (100) ml of raw goat's milk bought from a street vendor is added in bottle 1 which…
A: In serial dilution, we systematically dilute the sample by transferring a small amount of the sample…
Q: 14.23) All forms of life can have their cells invaded by viruses. When viruses take over plant or…
A: Viruses are small infectious agents that can only replicate inside living host cells. They have a…
Q: Of course, one cannot stick a piece of tape to each carbon atom in the actual glucose molecule. But…
A: Cellular respiration: a collection of three metabolic pathways that include glycolysis,…
Q: How many total ATP are REQUIRED to make 2 molecules of glucose in the liver via GNG starting with 4…
A: Gluconeogenesis (abbreviated as GNG) is the metabolic pathway that synthesizes glucose molecules…
Q: why would you give 2 answers when clearly it is a multiple choice question with one answer
A: We know that the amino acid sequence of a polypeptide synthesized with respect to an mRNA is based…
Q: A. The aldaric acid of D-mannose is the same as the aldaric acid of which sugar? B. The aldaric acid…
A: A. The Aldaric acid of D-mannose is same as the aldaric acid of D-mannose (since only D-mannose is…
Q: Hey could someone please help me with this human biochem questions 1. Describe the process of…
A: Dietary lipid metabolism is a complex process that breaks complex lipid molecules into smaller…
Q: 1. For each structure, circle the sugar unit and identify the nucleotide as a ribonucleotide or a…
A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…
Q: Match the correct answers in column A with column B + Prepare the protein samples with SDS sample…
A: Gel electrophoresis adds another layer to electrophoresis that allows the separation of charged…
Q: The reaction in gluconeogenesis catalyzed by Glyceraldehyde-3-phosphate dehydrogenase (GADPH)…
A: Gluconeogenesis is the metabolic pathway that generates glucose from non-carbohydrate precursors.…
Q: The fatty acid side chains of the phospholipids in the inner mitochondrial membrane exhibit a large…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: What are the properties of protein?
A: Proteins are large, complex molecules composed of amino acids linked together by peptide bonds. They…
Q: You want to study the oxygen binding ability of hemoglobin at pH 7.4. How would you make up 500 ml…
A: To make 500 ml of 75 mM phosphate buffer, pH 7.4, starting with 1.00 M Na3PO4, you can use the…
Q: Researchers are manipulating the gene cxx2 for their experiments, and they have inserted a small…
A: As per the central dogma of biology, the flow of genetic information is from DNA -> RNA ->…
Q: A student purified a protein, resulting in a fraction with a volume of 240 µL. The sample has a…
A: Protein are measured by spectrophotometer. They absorb the ultraviolet radiations at specific…
Q: Give other sources of starch and glycogen that you can use as raw materials to isolate starch and…
A: Starch : It is a complex carbohydrate or polysaccharide composed of glucose molecules. It is the…
Q: Below are three case scenarios. For each scenario determine: 1. Most likely enzyme deficiency and…
A: These three case studies illustrate various illnesses connected to the metabolism of amino acids. We…
Q: how do low levels of NADH regulate the CAC?
A: CAC, also known as the Krebs cycle act as a central metabolic pathway which generates energy in the…
Q: Q. What are the best ways to learn the pathways for biochemistry?
A: Biochemistry pathways are complex and interconnected, making mastery difficult. Effective strategies…
Q: -fatty acid synthesis RNA -> DNA Necessary to make RNA nucleotide G3P F6P &
A: Glucose-6-phosphate is a sugar molecule that is an important intermediate in several metabolic…
Q: Direct mutagenesis of Ca2+ ATPase gene resulted in the replacement of two amino acid residues -…
A: Ca2+ ATPase is a transmembrane protein found in the sarcoplasmic reticulum of the muscle cells. It…
Q: how many ATP molecules are used and how many are made in total? A diagram summarizing the
A: Glycolysis is a key metabolic activity present in all living organisms. It takes place in the…
Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Evaluate the properties and biological roles of Carbohydrates
A: Carbohydrates serve as a predominant and vital energy source for organisms. They are broken down…
Q: the class of enzymes to which it belongs to, ii) name the kind of bond that is modified due to its…
A: Enzymes are proteins that catalyse biochemical reactions. Enzymes show high substrate specificity…
Q: Consider the structure of following peptide from human brain. Identify part of the structure which…
A: First, lets take a look at the structures of the 5 opioid compounds. Morphine Codeine Oxycodone…
Q: 24. What is the byproduct of cholesterol metabolism involved with digestion and what is its role?
A: The body needs cholesterol, a lipid molecule. It is needed for cell membranes, hormone and vitamin D…
Q: 14. In competitive inhibition, an inhibitor— binds reversibly at the active site. binds to both…
A: Enzymes are biological catalysts that increase the rate of chemical reactions in living organisms…
Q: Sort the following molecules based on their Gibb's free energy level, from high energy to low…
A: Gibbs's free energy is the amount of free energy available in a system or molecule to do work,…
Q: Which of the following intermediates of the TCA cycle has 5 carbons? (Hint: You don't need to have…
A: In the tricarboxylic acid (TCA) cycle, also known as the citric acid cycle or Krebs cycle, a series…
Q: Hyaluronic acid
A: here is your solution Hyaluronic acid: Hyaluronic acid is a naturally occurring biopolymer…
Q: For the chloroplast, the thylakoid membrane separates the thylakoid lumen from the stroma; the…
A: In chloroplasts, the movement of electrons though the electron carriers in the thylakoid membrane…
Q: Explain the difference between ketogenesis and ketoacidosis.
A: Ketogenesis is a metabolic process that involves the breakdown of fatty acids and certain ketogenic…
Q: Can the fatty acid B be used to generate glucose in animals and is this possible for an unbranched…
A: Beta oxidation: The enzyme fatty acyl-CoA synthase (FACS) adds a CoA group to the fatty acid chain…
Q: 2.2.2. Describe how the sodium-glucose co-transporter achieves its function at the molecular level.…
A: The molecular function of the SGLT2 protein is to couple the transport of glucose with movement of…
Q: explain glucose regulation
A: Carbohydrate from food is converted to glucose by digestive enzymes which then enters the…
Q: 45. What role do enzymes play in the cell with regards to chemical reactions? Can they work against…
A: Enzymes help chemical reactions in cells. Biochemical processes depend on their catalytic abilities.…
Q: What is chemical reaction
A: Biochemistry is the branch of science that focuses on the study of chemical processes and reactions…
Q: DNA: 3. 2. 1: what is #1? 3: (name the sugar) 2: N bases used RNA: 3. 1: what is #1? 2. 3: (name the…
A: In the given question we have two figures One of the DNA and the other of RNA. DNA consists of a…
Q: Describe the unique fate of organic carbon and phosphorus during sequential anaerobic-aerobic…
A: Sequential anaerobic-aerobic cycling refers to a wastewater treatment process that involves…
Q: Based on the image below and your knowledge of amino acids, select all of the correct statements…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a chemically diverse…
Step by step
Solved in 3 steps
- 51. Which of the following statements is/are TRUE on the levels of prevention?I. Primary prevention occurs before the pathological onset of disease. Its aim is to block the start ofdisease.II. Secondary prevention takes place from the pathological onset of disease to the occurrence of clinicalsymptoms. It aims is to delay the onset and duration of symptomatic disease and improve survival.III. Tertiary prevention takes place after clinical symptoms develop. Its aim is to slow or block theprogression of disease and therefore reduce disease sequelae and improve survival.IV. All prevention activities may have the added benefit of reducing or halting the spread of disease.V. All prevention activities assume that the action taken will reduce the occurrence of disease and itsaftereffects.A. I, II B. I, II, III C. I, II, III, IV D. I, II, IVA 5. Macrolides: a. Which step in protein synthesis does this class of drugs inhibit? b. Do you think this class of drugs would be more effective in blocking the synthesis of small or large proteins? Why? !!6. Serum blood of a patient with dislipoproteinemia type I has milky appearance even in fasting. If serum stays at low temperature (4) for several hours, the fatty layer appears on its surface. What are the possible causes of these symptoms? Answer the questions and do the following tasks: a) what compounds of serum blood must be tested in the patient in a biochemical lab? b) what is the possible diagnosis of the discase? c) draw the reaction which does not occur properly in the patient's blood; d) explain how the products of the previous reaction are used in adiposc tissue and heart in a healthy person I hour after meal.
- 8. The physician orders Norvir (ritonavir) 0.9 g PO b.i.d. If the label states 81 mg per mL, a) How many mL of the anti-viral, protease inhibitor should your client receive in one dose? b) How many grams of this protease inhibitor would your client need in order to have a one- week supply of the drug?Which of these statements is true? An antibiotic is any substance produced by a organism that is antagonistic to the growth of prokaryotes An antibiotic is any substance produced by a prokaryote that is antagonistic to the growth of other viruses An antibiotic is any substance produced by a prokaryote that is antagonistic to the growth of eukaryotic cells An antibiotic is any substance produced by a prokaryote that prevents growth of the same prokaryote.2. Define the term "Pharmacodynamics" and explain how this concept helps in the understanding of the role and efficacy of anti-retroviral drugs. Definition:
- 4. CHOOSE THE RIGHT ANSWERS: according to Federal Law of the Russian Federation "On Circulation of Medicines" No. 61-FZ (chapter 12, article 60) state regulation of prices for medicinal products for medical use is carried out by means of: a) approval by the Government of the Russian Federation of a list of vital and essential medicinal products; b) approval of the methodology for determining the manufacturers' maximum ex-works prices for the medicinal products included in the list of vital and the essential medicinal products and introduction of mechanisms for creating a system of reference prices; c) state registration of the manufacturers' maximum ex-works prices for the medicinal products included in the list of vital and essential medicinal products; d) maintaining of the state register of the manufacturers' maximum ex-works prices for the medicinal products included into the list of vital and essential medicinal products; e) approval of the methodology for determination by…6. Provide the target of ciprofloxacin as well as the group of antibiotics it belongs to.2. Would detection of fecal coliforms (ex E. c/oli) in meat be indicative of contamination or spoilage of the product? Explain.
- 5. How are methods of precipitating proteins, such as heat and treatment with alcohol, also successful in killing harmful microorganisms?2. Describe how orally taken antibiotics can result in the harmful alteration in digestive functions and disease.1. Determine the minimum inhibitory concentration and the minimum exposure time given the following data: Number of colonies of E. coli on Nutrient Agar plates Exposure time (in minutes) Concentration of ethanol 10 15 Distilled water +++ +++ +++ 40% +++ ++ + 70% 95% Minimum inhibitory concentration: Minimum exposure time:
