1. Propose a mechanism by which HIV protease hydrolytically cleaves the peptidebond of the substrate shown in the active site. The mechanism you drawrequires only two steps containing arrows, you can draw arrows on top of theimage shown at left.Draw 3 arrows(Step 1)OHAsp25HIV proteaseFigure 6-24Lehninger Principles of Biochemistry, Seventh Edition© 2017 W. H. Freeman and CompanyAsp25Draw 2 arrows(Step 2)Show Final Products& EnzymeBetween which 2 amino acids is the protease cleavage occurring?

Proteins can be degraded by breaking the peptide bonds that hold amino acid residues together.…

Answered: 1. Propose a mechanism by which HIV…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Antimicrobial Corning®Gorilla®Glass Protein Synthesis IT Uonsan Review Base your answer to the question on the diagram below, which represents a process that occurs in living cells, and on your knowledge of biology. Newly formed molecule Glycine Arginine Proline HAlanine Glycine CỦA MRNA Structure X The process shown in the diagram is 1. cellular respiration 2. cellular reorganization 3. gene recombination 4. protein synthesis Zoom: Standard EX Note Bookmark Eliminator Highlighter P Line Reader Calculator Ruler Reference Protractor Coming soon
I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?
Choose the correct option for following three mcqs 7.The first step in the capping reaction is catalyzed by: Phosphatase Guanylyl transferase Methyl transferase Kinase None of the above 8.Which of the following statements about tRNAs is FALSE? They contain an anti-codon loop They contain several modified bases Their secondary structure looks like a cloverleaf They are generally less then 100 nucleotides in length They are synthesized by RNA polymerase-II 9.During protein synthesis _____ delivers the charged tRNA to the A-site. EF-Tu EF-G eIF-2 RF1 RF2
8.Iron-uptake protein IupA is a human 302-aa, N-glycosylated, heterodimeric protein of considerable therapeutic interest. It contains 3 disulfide bridges that stabilise its structure. Explain what expression host you would use to produce the protein in recombinant form.
Match the ribosome antibiotics with their binding sites and activities Puromycin [ Choose ] Macrolides (azithromycin, i.e., Z-pak) [ Choose ] Aminoglycosides (kanamycin) [ Choose ] Chloramphenicol V[Choose ] Binds the 30S subunit at the decoding site, interferes with decoding, leading to mis-reading andproduction Binds the E site and prevents de-acylated tRNAs from exiting. This drives pt'ase activity backwards and Binds the A site and mimics an aa-TRNA, is added onto the growing peptide chain by the pt'ase activity of Binds the peptidyltransferase site and blocks pt'ase activity, may also block the TRNAS from entering the A
topic: Bradford AssayThere are numerous methods of protein determination in use, but this module focuses on the Bradford assay.The Bradford assay is a dye-binding method that employs Coomassie Brilliant Blue G-250, whose structureis shown in Figure 2.3.4.1. Coomassie Brilliant Blue G-250 is a dye that interacts with proteins throughhydrophobic and electrostatic interactions. What are the identities and functions of the components of the Bradford reagent in protein contentdetermination?
MRNA- based therapeutics The following questions: Which research group has initially developed the technology? What was the purpose behind the invention of the technology? What type of questions could be answered with the technology? What are the applications of the technology? Are there any clinical trials associated with the method? What is the mechanism of action for the technology?
Rabbits were in injected with [32 P] photsphate intraperitoneally ans asacrificed after 2, 5, 8, 12, 18, 24, 48, or 168 hours of radioisotope administration. DNA, nuclear RNA (nRNA), and cytoplasmic RNA (cRNA) were prepared from the kidneys and their specific activities (radioactivity/ mg of nucleic acid) were determined 1. what process was studied in this expereiement 2. What is concluded about the division of kideny cells during the time of labeling and why.
Cell wall bullding block D-Ala-D-Alal-Lys-tail NH,Me Heptapeptide backbone R1 R. R2 ii) With the aid of the figure above showing the important features of the binding of Vancomycin (lower part) to a bacterial cell wall peptia discuss the antibiotic effect of Vancomycin. i) Vancomycin resistant strains often have a mutation in which one of the D-Ala moieties is exchanged to a D-lactate moiety. Discuss why this mutation makes the strain Vancomycin- resistant but still viable. iv) Glycoconjugate vaccines based on bacterial capsular polysaccharides have been used for 30 years without any need for changes in their structures, while the flu vaccine, based on attenuated or killed virus particles, requires many different structures and a check each time when there is an epidemic that the right vaccine is used. Discuss the reason behind this.
The SARS-Cov-2 virus is the virus that cause COVID-19. The viral protease is a known target for finding potential viral inhibitor. The activity of the viral protease can be assayed using the synthetic peptide substrate attached to 7-amino-4-carbamoylmethylcoumarin (PACC). The viral protease cleaved the substrate producing the fluorogenic ACC which can be monitored using a spectrofluorometer. The following is data from SARS-Cov-2 protease (0.1 mg of enzyme) upon reaction with various concentrations of the substrate PACC. Plot the appropriate graphs to find: - The approximate Vmax from the Michaelis-Menten curve.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
Rabbits were in injected with [32 P] photsphate intraperitoneally ans asacrificed after 2, 5, 8, 12, 18, 24, 48, or 168 hours of radioisotope administration. DNA, nuclear RNA (nRNA), and cytoplasmic RNA (cRNA) were prepared from the kidneys and their specific activities (radioactivity/ mg of nucleic acid) were determined 1. what can be concluded from the nRNA and cRNA curves and why 2. why didn thte specific acitivies of nRNA's and cRNA's decrease significantly after 2 days of labeling.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS

1. Propose a mechanism by which HIV protease hydrolytically cleaves the peptide bond of the substrate shown in the active site. The mechanism you draw requires only two steps containing arrows, you can draw arrows on top of the image shown at left.