1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of 5 nucleotides (aka, a 5-mer)   a)How many possible 5-mers are there? Remember that each position in the 5-mer has one of four nucleotides.   b) Pick a 5-nucleotide position at random in the genome: what’s the probability that your forward primer matches there? Focus for now just on one strand of DNA.    c) Pick a random 5-nucleotide position in the genome: what’s the probability that your forward primer does NOT match there? Focus for now just on one strand of DNA.    d) How many physical locations might your forward primer sit in the genome? Focus just on one strand of DNA. Ignore whether or not it matches at a given location. this is one question with different parts. I would really appreciate it if all parts are answered. and I will defiantly rate.

Q: please solve this with step-by-step calculations and explanations.

A: The following is a step-by-step solution to this problem:a. In order to determine the melting…

Q: Sequence A AC GAATTC (EcoRI) NNNN... Sequence Probability Calculation Length 1 2 6 n 1/4 = (1/4)¹=…

A: DNA is two stranded , helical twisted structure that serves as genetic material in most of the…

Q: GAT C |||||||| ||||| | || | | || | || | || a.) What is the base sequence of the sample ssDNA? b.) If…

A: NUCLEOTIDE SEQUENCING: The process of determining the order of nucleotides in a genome is known as…

Q: 1f) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same…

A: Deoxyribonucleic acid  is a particle made out of two polynucleotide chains that loop around one…

Q: Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…

A: (A) No. Of base pairs in the bacterium continue Some important Data-- Molecular weight of one base…

Q: 5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and…

A: BamHI is a type II restriction endonuclease can identify specific restriction site and induce cut on…

Q: 18. What does "highly variable" mean? 19. Why are highly variable regions important in this lab? 20.…

A: Polymerase Chain Reaction ( PCR )-- PCR was first developed in year 1983 by Kary Mullis .Polymerase…

Q: Indicate 2 differences between SSLP (simple sequence length polymorphism) and SNP (single nucleotide…

A: SSLPs are called Simple Sequence Length Polymorphism. These are arrays of repeat sequences that…

Q: What fraction of the binturong genomic DNA would be considered to be "highly repetitive" DNA, based…

A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…

Q: c.) ( between turns, glycosidic bond conformation and sugar conformation differs between A-form DNA…

A: DNA, is basically called deoxyribonucleic acid, is the hereditary material in humans and almost all…

Q: Below are 9 possible primer pairs. Determine which primer pair is the best choice by considering the…

A: Introduction :- Primers are short oligonucleotide sequence which are required for starting or…

Q: You are working in a biotechnology lab and are analyzing DNA. You obtain a sample of a short…

A: DNA is present inside the nucleus and consists of instructions for the synthesis of protein. The…

Q: 6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design…

A: The PCR or polymerase chain reaction is a technique in which a particular DNA sequence is amplified…

Q: How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below.…

A: The question inquires about the Sanger sequencing method, a strategy utilized to decide the grouping…

Q: 7 a-d. i. ii. Draw the Hydrogen bonds between the base pairs and label the atoms that participate in…

A: There are 2 conventional base pairs in DNA. They are; Between Adenine and Thymine Between Guanine…

Q: Your PhD thesis advisor has given you the task of preparing a human genomic DNA library.  3a. How…

A: The length of the human genome is approximately 3.2 billion bases with genes of 20000-25000 protein…

Q: 1. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in…

A: Introduction :  The primary nucleobases are cytosine (DNA and RNA), guanine (DNA and RNA), adenine…

Q: Can you please help with 1d please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: Binturong or the bearcat is found in South and Southeast Asia. It is declared as vulnerable,…

Q: 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full…

A: Primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. It is used…

Q: a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x…

A: Sure, let me provide a more detailed explanation for the calculations.a) Calculating the number of…

Q: How would the appearance of your DNA gel change if a 0.1% agarose gel slab was used? What about a 7%…

A: If 0.1% agarose gel slab was used then DNA cannot be seen clearly, it will break.Low…

Q: The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17…

A: The bacteriophage is those viruses that have the capability to infect bacteria and reproduce inside…

Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…

A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…

Q: РО P3mod 5' GAGTTTGATCMTGGCTCAG 3' .5' ATTAGATACCCTDGTAGTCC 3'

A: Answer well explained above

Q: A 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the…

A: The DNA is made up of nucleotides that contain nitrogenous bases, pentose sugar and phosphate group.…

Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Agarose gel electrophoresis is a method of gel electrophoresis that is used to separate a mixed…

Q: 8. Given the following two sequences, create a pairwise alignment by hand. Do not place any gaps in…

A: Introduction :- When the cell needs energy, ATP can be taken out and used to fuel processes or…

Q: What is the length in basepairs of these sequences? How many base substitutions are there between…

A: The multiple sequence alignment (MSA) involves the alignment of three or greater than three…

Q: Can you please help with 1c please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: We know that E. coli is a prokaryote and Binturong is a eukaryotic animal. On studying the DNA…

Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…

A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…

Q: 13- Which statement is not correct for primer design criteria? a) In the length of 18-22 nt b)…

A: A primer is a sequence of short, single-stranded DNA used in the technique of polymerase chain…

Q: 3a)ClustalX software was used to perform multiple sequence alignment of the following five Nco…

A: Some frequently performed analysis via bioinformatics are DNA sequence analysis, amino acid…

Q: if i had 3 sequences that were 15 nucleotides long. how would i make an optimal sequence alignment…

A: Aligning one or more sequences by introducing gaps is termed as gap penalty method. The introduction…

Q: Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy"…

A: Sanger sequencing is done to identify the sequence of DNA. In this process, a particular ddNTP is…

Q: double-stranded DNA is dissociated into

A: All organisms must replicate their DNA when cells divide. During DNA replication, an enzyme called…

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is…

Q: Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide…

A: Given : Ser-Gly-Lys-Glu-Gly-Lys-Lys 1 amino acid : 3 codons 7 amino acids : 7×3= 21 codons

Q: Each of the following sequences has a total of 20 nucleotides (note that the first six are the same…

A: Introduction Stem-loop formation occurs in single-stranded RNA when two regions of the same strand…

Q: If you had the RNA sequence below: 5' UUUGGAG 3' and you were going to make a piece of DNA that…

A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…

Q: Looking at each of the fragments (100, 200, 300 base pairs etc.). Why are there so many of the…

A: Restriction fragment length polymorphism (RFLP) is a type of polymorphism that results from…

Q: Can you please help with 1c please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: We know that E. coli is a prokaryote and Binturong is a eukaryotic animal. On studying the DNA…

Q: Compute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... |…

A: In bioinformatics, sequence alignment is a process by which two or more sequences are arranged to…

Q: The DNA of a deletion mutant of λ bacteriophage has a length of 15.4383 μm instead of 19.6356 μm.…

A: The mutation is the change in the nucleotide base pairs or in the DNA sequence which can be because…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.