
Concept explainers
Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence
What is the amino acid sequence of the polypeptideproduced from this sequence?
What term is used to identify a functional protein like this one formed when two identical polypeptides jointogether?

To analyze:
Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.
From this sequence, the amino acid sequence of the polypeptide produced is to be explained.
Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.
Introduction:
In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.
Transcription Translation
DNA → mRNA → polypeptide
The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.
Amino acid → polypeptide → Protein molecule
Explanation of Solution
The DNA template will undergo the following process to form the polypeptide chain:
3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template
↓ Transcription
5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA
↓ Translation
N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain
Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.
The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.
The term “homodimer” is used when two identical polypeptide chains are bounded together.
Want to see more full solutions like this?
Chapter 9 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- Design a grafting experiment to determine if limb mesoderm determines forelimb / hindlimb identity. Include the experiment, a control, and an interpretation in your answer.arrow_forwardThe Snapdragon is a popular garden flower that comes in a variety of colours, including red, yellow, and orange. The genotypes and associated phenotypes for some of these flowers are as follows: aabb: yellow AABB, AABb, AaBb, and AaBB: red AAbb and Aabb: orange aaBB: yellow aaBb: ? Based on this information, what would the phenotype of a Snapdragon with the genotype aaBb be and why? Question 21 options: orange because A is epistatic to B yellow because A is epistatic to B red because B is epistatic to A orange because B is epistatic to A red because A is epistatic to B yellow because B is epistatic to Aarrow_forwardA sample of blood was taken from the above individual and prepared for haemoglobin analysis. However, when water was added the cells did not lyse and looked normal in size and shape. The technician suspected that they had may have made an error in the protocol – what is the most likely explanation? The cell membranes are more resistant than normal. An isotonic solution had been added instead of water. A solution of 0.1 M NaCl had been added instead of water. Not enough water had been added to the red blood cell pellet. The man had sickle-cell anaemia.arrow_forward
- A sample of blood was taken from the above individual and prepared for haemoglobin analysis. However, when water was added the cells did not lyse and looked normal in size and shape. The technician suspected that they had may have made an error in the protocol – what is the most likely explanation? The cell membranes are more resistant than normal. An isotonic solution had been added instead of water. A solution of 0.1 M NaCl had been added instead of water. Not enough water had been added to the red blood cell pellet. The man had sickle-cell anaemia.arrow_forwardWith reference to their absorption spectra of the oxy haemoglobin intact line) and deoxyhemoglobin (broken line) shown in Figure 2 below, how would you best explain the reason why there are differences in the major peaks of the spectra? Figure 2. SPECTRA OF OXYGENATED AND DEOXYGENATED HAEMOGLOBIN OBTAINED WITH THE RECORDING SPECTROPHOTOMETER 1.4 Abs < 0.8 06 0.4 400 420 440 460 480 500 520 540 560 580 600 nm 1. The difference in the spectra is due to a pH change in the deoxy-haemoglobin due to uptake of CO2- 2. There is more oxygen-carrying plasma in the oxy-haemoglobin sample. 3. The change in Mr due to oxygen binding causes the oxy haemoglobin to have a higher absorbance peak. 4. Oxy-haemoglobin is contaminated by carbaminohemoglobin, and therefore has a higher absorbance peak 5. Oxy-haemoglobin absorbs more light of blue wavelengths and less of red wavelengths than deoxy-haemoglobinarrow_forwardWith reference to their absorption spectra of the oxy haemoglobin intact line) and deoxyhemoglobin (broken line) shown in Figure 2 below, how would you best explain the reason why there are differences in the major peaks of the spectra? Figure 2. SPECTRA OF OXYGENATED AND DEOXYGENATED HAEMOGLOBIN OBTAINED WITH THE RECORDING SPECTROPHOTOMETER 1.4 Abs < 0.8 06 0.4 400 420 440 460 480 500 520 540 560 580 600 nm 1. The difference in the spectra is due to a pH change in the deoxy-haemoglobin due to uptake of CO2- 2. There is more oxygen-carrying plasma in the oxy-haemoglobin sample. 3. The change in Mr due to oxygen binding causes the oxy haemoglobin to have a higher absorbance peak. 4. Oxy-haemoglobin is contaminated by carbaminohemoglobin, and therefore has a higher absorbance peak 5. Oxy-haemoglobin absorbs more light of blue wavelengths and less of red wavelengths than deoxy-haemoglobinarrow_forward
- Which ONE of the following is FALSE regarding haemoglobin? It has two alpha subunits and two beta subunits. The subunits are joined by disulphide bonds. Each subunit covalently binds a haem group. Conformational change in one subunit can be transmitted to another. There are many variant ("mutant") forms of haemoglobin that are not harmful.arrow_forwardWhich ONE of the following is FALSE regarding haemoglobin? It has two alpha subunits and two beta subunits. The subunits are joined by disulphide bonds. Each subunit covalently binds a haem group. Conformational change in one subunit can be transmitted to another. There are many variant ("mutant") forms of haemoglobin that are not harmful.arrow_forwardDuring a routine medical check up of a healthy man it was found that his haematocrit value was highly unusual – value of 60%. What one of the options below is the most likely reason? He will have a diet high in iron. He is likely to be suffering from anaemia. He lives at high altitude. He has recently recovered from an accident where he lost a lot of blood. He has a very large body size.arrow_forward
- Explain what age of culture is most likely to produce an endospore?arrow_forwardExplain why hot temperatures greater than 45 degrees celsius would not initiate the sporulation process in endospores?arrow_forwardEndospore stain: Consider tube 2 of the 7-day bacillus culture. After is was heated, it was incubated for 24 hours then refrigerated. Do you think the cloudiness in this tube is due mostly to vegetative cells or to endospores? Explain your reasoningarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning





