Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'-TACGTAGGCTAACGGAGTAAGCTAACT-5' produces a polypeptide that joins in pairs to form a functional protein. What is the amino acid sequence of the polypeptideproduced from this sequence? What term is used to identify a functional protein like this one formed when two identical polypeptides jointogether?

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 9, Problem 1P

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'-TACGTAGGCTAACGGAGTAAGCTAACT-5' produces a polypeptide that joins in pairs to form a functional protein.

What is the amino acid sequence of the polypeptideproduced from this sequence?

What term is used to identify a functional protein like this one formed when two identical polypeptides jointogether?

Expert Solution & Answer

Summary Introduction

To analyze:

Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.

From this sequence, the amino acid sequence of the polypeptide produced is to be explained.

Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.

Introduction:

In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.

Transcription Translation

DNA → mRNA → polypeptide

The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.

Amino acid → polypeptide → Protein molecule

Explanation of Solution

The DNA template will undergo the following process to form the polypeptide chain:

3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template

↓ Transcription

5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA

↓ Translation

N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain

Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.

Conclusion

The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.

The term “homodimer” is used when two identical polypeptide chains are bounded together.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Amino Acid Coclow TABle 3' Gly Phe Leu (G) (F) (L) 3- Val (V) Arg (R) Ser (S) Ala (A) Lys (K) CAG G Glu Asp (E) (D) Ser (S) CCCAGUCAGUCAGUCAG 0204 C U A G C Asn (N) G 4 A AGU C GU (5) AC C UGA A G5 C CUGACUGACUGACUGAC Thr (T) Met (M) lle £€ (1) U 4 G Tyr Σε (Y) U Cys (C) C A G Trp (W) 3' U C A Leu בוט His Pro (P) ££ (H) Gin (Q) Arg 흐름 (R) (L) Start Stop 8. Transcription and Translation Practice: (Video 10-1 and 10-2) A. Below is the sense strand of a DNA gene. Using the sense strand, create the antisense DNA strand and label the 5' and 3' ends. B. Use the antisense strand that you create in part A as a template to create the mRNA transcript of the gene and label the 5' and 3' ends. C. Translate the mRNA you produced in part B into the polypeptide sequence making sure to follow all the rules of translation. 5'-AGCATGACTAATAGTTGTTGAGCTGTC-3' (sense strand) 4

What is the structure and function of Eukaryotic cells, including their organelles? How are Eukaryotic cells different than Prokaryotic cells, in terms of evolution which form of the cell might have came first? How do Eukaryotic cells become malignant (cancerous)?

What are the roles of DNA and proteins inside of the cell? What are the building blocks or molecular components of the DNA and proteins? How are proteins produced within the cell? What connection is there between DNA, proteins, and the cell cycle? What is the relationship between DNA, proteins, and Cancer?

Answer 2

Textbook Question

Chapter 9, Problem 1P

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'-TACGTAGGCTAACGGAGTAAGCTAACT-5' produces a polypeptide that joins in pairs to form a functional protein.

What is the amino acid sequence of the polypeptideproduced from this sequence?

What term is used to identify a functional protein like this one formed when two identical polypeptides jointogether?

Expert Solution & Answer

Summary Introduction

To analyze:

Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.

From this sequence, the amino acid sequence of the polypeptide produced is to be explained.

Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.

Introduction:

In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.

Transcription Translation

DNA → mRNA → polypeptide

The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.

Amino acid → polypeptide → Protein molecule

Explanation of Solution

The DNA template will undergo the following process to form the polypeptide chain:

3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template

↓ Transcription

5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA

↓ Translation

N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain

Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.

Conclusion

The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.

The term “homodimer” is used when two identical polypeptide chains are bounded together.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 9, Problem 1P

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'-TACGTAGGCTAACGGAGTAAGCTAACT-5' produces a polypeptide that joins in pairs to form a functional protein.

What is the amino acid sequence of the polypeptideproduced from this sequence?

What term is used to identify a functional protein like this one formed when two identical polypeptides jointogether?

Expert Solution & Answer

Summary Introduction

To analyze:

Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.

From this sequence, the amino acid sequence of the polypeptide produced is to be explained.

Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.

Introduction:

In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.

Transcription Translation

DNA → mRNA → polypeptide

The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.

Amino acid → polypeptide → Protein molecule

Explanation of Solution

The DNA template will undergo the following process to form the polypeptide chain:

3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template

↓ Transcription

5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA

↓ Translation

N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain

Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.

Conclusion

The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.

The term “homodimer” is used when two identical polypeptide chains are bounded together.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 9, Problem 1P

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'-TACGTAGGCTAACGGAGTAAGCTAACT-5' produces a polypeptide that joins in pairs to form a functional protein.

What is the amino acid sequence of the polypeptideproduced from this sequence?

What term is used to identify a functional protein like this one formed when two identical polypeptides jointogether?

Expert Solution & Answer

Summary Introduction

To analyze:

Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.

From this sequence, the amino acid sequence of the polypeptide produced is to be explained.

Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.

Introduction:

In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.

Transcription Translation

DNA → mRNA → polypeptide

The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.

Amino acid → polypeptide → Protein molecule

Explanation of Solution

The DNA template will undergo the following process to form the polypeptide chain:

3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template

↓ Transcription

5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA

↓ Translation

N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain

Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.

Conclusion

The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.

The term “homodimer” is used when two identical polypeptide chains are bounded together.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

To analyze:

Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.

From this sequence, the amino acid sequence of the polypeptide produced is to be explained.

Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.

Introduction:

In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.

Transcription Translation

DNA → mRNA → polypeptide

The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.

Amino acid → polypeptide → Protein molecule

Explanation of Solution

The DNA template will undergo the following process to form the polypeptide chain:

3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template

↓ Transcription

5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA

↓ Translation

N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain

Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.

Conclusion

The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.

The term “homodimer” is used when two identical polypeptide chains are bounded together.

Answer 8

Expert Solution & Answer

Summary Introduction

To analyze:

Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.

From this sequence, the amino acid sequence of the polypeptide produced is to be explained.

Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.

Introduction:

In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.

Transcription Translation

DNA → mRNA → polypeptide

The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.

Amino acid → polypeptide → Protein molecule

Explanation of Solution

The DNA template will undergo the following process to form the polypeptide chain:

3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template

↓ Transcription

5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA

↓ Translation

N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain

Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.

Conclusion

The amino acid sequence of a polypeptide chain is determined by the sequence of codons present on the DNA template strand.

The term “homodimer” is used when two identical polypeptide chains are bounded together.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

To analyze:

Few proteins are composed of two or more polypeptides. Assume the DNA template strand sequence 3’-TACGTAGGCTAACGGAGTAAGCTAACT-5’ yields a polypeptide that joins in sets to form a functional protein.

From this sequence, the amino acid sequence of the polypeptide produced is to be explained.

Name the term used to identify a functional protein which is produced from the joining of two identical polypeptides.

Introduction:

In molecular biology, the central dogma describes the formation of a polypeptide chain from the template DNA strand through the intermediate formation of mRNA.

Transcription Translation

DNA → mRNA → polypeptide

The DNA contains the information for the given polypeptide in the form of specific sequences of codons. The codon is a triplet of nitrogen bases coding the specific amino acid. There are 64 codons which code 20 different types of amino acids. These amino acids are bounded together by a peptide bond to form polypeptide. The number of polypeptides bounded together form the protein molecule.

Amino acid → polypeptide → Protein molecule

Answer 12

Explanation of Solution

The DNA template will undergo the following process to form the polypeptide chain:

3’ TACGTAGGCTAACGGAGTAAGCTAACT5’ DNA template

↓ Transcription

5’AUGCAUCCGAUUGCCUCAUUCGAUUGA3 mRNA

↓ Translation

N-Met-His-Pro-Ileu-Ala-Ser-Phe-Asp-Stop-C Polypeptide chain

Functional proteins are made up of two or more polypeptide chains which may be same or different to each other. As the two polypeptides chains are identical in nature, they will join together to form a homodimer.