Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 1AQ
Not all proteins are made from the RNA genome of bacteriophage MS2 in the same amounts. Can you explain why? One of the proteins functions very much like a repressor, but it functions at the translational level. Which protein is it and how does it function?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents the formation of peptide bonds during translation. A model of the translation process is shown in the diagram.
Which of the following describes where in the model chloramphenicol acts to interfere with the production of proteins from DNA?
during initiation
during elongation
during termination
during protein release
A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a tRNA that recognizes the codon GAA, and is charged with the amino acid glutamic acid (Glu). The mutant tRNA is still charged with Glu, but it recognizes the codon UAA. What effect will this have on translation in these cells? How will the proteins produced be different?
Speculate: is this mutation more likely to be beneficial or harmful?
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
Chapter 9 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 9.1 - Distinguish between a positive-strand RNA virus...Ch. 9.1 - Prob. 2MQCh. 9.1 - Prob. 3MQCh. 9.2 - Prob. 1MQCh. 9.2 - Prob. 2MQCh. 9.2 - Prob. 3MQCh. 9.3 - Prob. 1MQCh. 9.3 - In the X174 genome, describe the difference...Ch. 9.3 - Prob. 3MQCh. 9.4 - In what major way does transcription of phage DNA...
Ch. 9.4 - Prob. 2MQCh. 9.5 - What type of genome is seen in most archaeal...Ch. 9.5 - Compared with other archaeal viruses, what are two...Ch. 9.6 - Prob. 1MQCh. 9.6 - Prob. 2MQCh. 9.6 - Prob. 3MQCh. 9.7 - Prob. 1MQCh. 9.7 - Prob. 2MQCh. 9.7 - Prob. 3MQCh. 9.8 - Prob. 1MQCh. 9.8 - Prob. 2MQCh. 9.8 - How are protein synthesis and genomic replication...Ch. 9.9 - Prob. 1MQCh. 9.9 - Prob. 2MQCh. 9.9 - Prob. 3MQCh. 9.10 - Prob. 1MQCh. 9.10 - Prob. 2MQCh. 9.10 - Prob. 3MQCh. 9.11 - Prob. 1MQCh. 9.11 - Prob. 2MQCh. 9.11 - How does the role of reverse transcriptase in the...Ch. 9.12 - If viroids are circular molecules, why are they...Ch. 9.12 - Prob. 2MQCh. 9.13 - Prob. 1MQCh. 9.13 - Prob. 2MQCh. 9.13 - Prob. 3MQCh. 9 - Prob. 1RQCh. 9 - Describe the classes of viruses based on their...Ch. 9 - REVIEW QUESTIONS
3. How might viruses help...Ch. 9 - Prob. 4RQCh. 9 - Describe how the genome of bacteriophage X174 is...Ch. 9 - Why can it be said that transcription of the...Ch. 9 - Prob. 7RQCh. 9 - Prob. 8RQCh. 9 - Prob. 9RQCh. 9 - Prob. 10RQCh. 9 - Prob. 11RQCh. 9 - Prob. 12RQCh. 9 - Prob. 13RQCh. 9 - Prob. 14RQCh. 9 - Rabies virus and poliovirus both have...Ch. 9 - Prob. 16RQCh. 9 - Why do both hepadnaviruses and retroviruses...Ch. 9 - Prob. 18RQCh. 9 - What are the similarities and differences between...Ch. 9 - Prob. 20RQCh. 9 - Not all proteins are made from the RNA genome of...Ch. 9 - Replication of both strands of DNA in adenoviruses...Ch. 9 - Imagine that you are a researcher at a...Ch. 9 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You’re going for a bike ride, and as your muscles work harder, your body needs to produce more of the enzyme. You now know genes are transcribed from DNA into RNA in the nucleus and translated from RNA into proteins by ribosomes. Explain the steps of its creation from DNA to protein. Aside for having a nasty inhibitor around like the one from that insecticide, how else might an enzyme end up being non-functioning? During transcription, a base substitution occurred. Explain two reasons why this change in nucleotide sequence could result in no change to the protein.arrow_forwardThe E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.arrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forward
- A mutation is found in a tRNA-encoding gene. The wild type allele produces a tRNA that recognizes the codon GAA, and is charged with the amino acid Glutamic acid. The mutant tRNA is still charged with Glu, but the anticodon is mutated such that it recognizes the stop codon TAA. What effect will this have on translation in these cells? Select all that apply In the mutant cells, the stop codon TAA will always be bound by the release factors In the mutant cells, some of the synthesized proteins will be longer. O In the mutant cells, the stop codon TAA will sometimes be bound by the mutant TRNA charged with Glutamic acid. O In the mutant cells, some of the synthesized proteins will be shorter.arrow_forwardResearchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents the formation of peptide bonds during translation. A model of the translation process is shown in the diagram. Which of the following describes where in the model chloramphenicol acts to interfere with the production of proteins from DNA? A - during initiationB - during elongationC = during terminationD = during protein releasearrow_forwardin a clever experiment performed in 1962, a cysteine already attached to its tRNA was chemically converted to an alanine. these “hybrid” tRNA molecules were then added to a cell- free translation system from which the normal cysteine-tRNAs had been removed. When the resulting protein was analyzed, it was found that alanine had been inserted at every point in the polypeptide chain where cysteine was supposed to be. Discuss what this experiment tells you about the role of aminoacyl- tRNA synthetases during the normal translation of the genetic code.arrow_forward
- The following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…arrow_forwarda) The deacetylation of histones generally causes gene inactivation. True or false? b)During eukaryotic translation, the first contact between the ribosome and the mRNA is usually made when the small ribosomal subunit directly binds to the translational start site (Kozak sequence) on the mRNA. True or false? c)The termination of translation is carried out by a single tRNA molecule that recognizes all three stop codons. True or false? d) The deamination of cytosine, which produces uracil, is less likely to be repaired, compared to the deamination of 5-methylcytosine, which produces thymine.True or false? e)An HLH-bHLH heterodimer can bind DNA. True or false? F)Chromatin remodeling complexes posseses ATPase activity. True or false? g)Histone methylation generally causes gene inactivation. True or false? h) A pre-mRNA is cleaved downstream of its polyA signal before the transcription terminates. True or false? i) During X chromosome inactivation in female mammals, most genes are repressed…arrow_forwardHydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.arrow_forward
- Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protienarrow_forwardThis sequence given is of one strand of eukaryotic DNA containing a hypothetical gene. The base that is first (at the 5' end) in the sequence is at position -25. The translational start site is the first initiating codon encountered after the transcriptional start. This gene has three exons. The last base of the first exon is the A at position +30; the first base of the second exon is the C at position +62; the last base of the second exon is the A at position +82; the first base of the third exon is the G at position +118; and the last base of the third exon is for you to determine. Determine, and show, the sequence of the polypeptide produced by this gene in this format: Met-Thr-Trp-Tyr-Val etc. 5'-TATATACGTC CTATCGATGC ATCGTGTACG TAGCTAGGGG ATGCATGAAG TCACAGTAGC TAGCTATGGC TGATCGATCG TTGTGGCTTA AATATTGCGC TGGACTAGGA AAAGCTCGCA GGTACCCGAT CGATCCCGTG GAGTTCCAAG TTAGGATCTA CTTTAGCTAG TTTTAGCGGA ATAAAGATCG ATTATAGCTG AGAGATAAGC GTGGGTTGAT GATCGTAGCT AGCTAGCTAG CTAGCATCGA-3'arrow_forwardHow does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license