Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.8, Problem 2MQ
Summary Introduction
Poliovirus cause Poliomyletis disease charecterized by bone and muscle deformities and make the affected person unable to move. Poliovirus have RNA based genome with single stranded positive sense RNA with 7.5 kb long. Poliovirus replicate inside the host cell with the help of RNA dependant RNA polymerase enzyme.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is the function of the Matrix protein during rabies virus pathogenesis?
What will be the effect of a mutation that turns glutamine into arginine?
a variant of the SARS-CoV-2 virus has been found in brazil. this variant contains the mutation K417N, where the amino acid K has been mutated to the amino acid N. K and N refers to the one letter codes of the amino acids.
a) state the names of the amino acids K and N.
b) state one difference between the properties of these 2 aminoacids
Chapter 9 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 9.1 - Distinguish between a positive-strand RNA virus...Ch. 9.1 - Prob. 2MQCh. 9.1 - Prob. 3MQCh. 9.2 - Prob. 1MQCh. 9.2 - Prob. 2MQCh. 9.2 - Prob. 3MQCh. 9.3 - Prob. 1MQCh. 9.3 - In the X174 genome, describe the difference...Ch. 9.3 - Prob. 3MQCh. 9.4 - In what major way does transcription of phage DNA...
Ch. 9.4 - Prob. 2MQCh. 9.5 - What type of genome is seen in most archaeal...Ch. 9.5 - Compared with other archaeal viruses, what are two...Ch. 9.6 - Prob. 1MQCh. 9.6 - Prob. 2MQCh. 9.6 - Prob. 3MQCh. 9.7 - Prob. 1MQCh. 9.7 - Prob. 2MQCh. 9.7 - Prob. 3MQCh. 9.8 - Prob. 1MQCh. 9.8 - Prob. 2MQCh. 9.8 - How are protein synthesis and genomic replication...Ch. 9.9 - Prob. 1MQCh. 9.9 - Prob. 2MQCh. 9.9 - Prob. 3MQCh. 9.10 - Prob. 1MQCh. 9.10 - Prob. 2MQCh. 9.10 - Prob. 3MQCh. 9.11 - Prob. 1MQCh. 9.11 - Prob. 2MQCh. 9.11 - How does the role of reverse transcriptase in the...Ch. 9.12 - If viroids are circular molecules, why are they...Ch. 9.12 - Prob. 2MQCh. 9.13 - Prob. 1MQCh. 9.13 - Prob. 2MQCh. 9.13 - Prob. 3MQCh. 9 - Prob. 1RQCh. 9 - Describe the classes of viruses based on their...Ch. 9 - REVIEW QUESTIONS
3. How might viruses help...Ch. 9 - Prob. 4RQCh. 9 - Describe how the genome of bacteriophage X174 is...Ch. 9 - Why can it be said that transcription of the...Ch. 9 - Prob. 7RQCh. 9 - Prob. 8RQCh. 9 - Prob. 9RQCh. 9 - Prob. 10RQCh. 9 - Prob. 11RQCh. 9 - Prob. 12RQCh. 9 - Prob. 13RQCh. 9 - Prob. 14RQCh. 9 - Rabies virus and poliovirus both have...Ch. 9 - Prob. 16RQCh. 9 - Why do both hepadnaviruses and retroviruses...Ch. 9 - Prob. 18RQCh. 9 - What are the similarities and differences between...Ch. 9 - Prob. 20RQCh. 9 - Not all proteins are made from the RNA genome of...Ch. 9 - Replication of both strands of DNA in adenoviruses...Ch. 9 - Imagine that you are a researcher at a...Ch. 9 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are Ligation points ?arrow_forwardA viral protein has a 20 amino acid amino acid chain consisting of the following primary structure: A-G-L-F-A-F-P-P-W-G-G-V-C-M-G-L-G-A-M-C In what places could these amino acids be found? a) Inside the hydrophobic core of a protein b) In a membrane that encloses the virus c) On the outside of a protein d) In a virus nail on the surface of the virusarrow_forward5'--TTAATGGGACAGCTTGTGTAGAGG--3' a.) What is the complementary strand of DNA? b.) What is the transcribed mRNA sequence? c.) What is the amino acid sequence translated from the strand of mRNA synthesized inarrow_forward
- What is adeno-associated virus (AAV) ?arrow_forwardResearchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking for versions of the virus that might be more easily transmitted between humans or that might be more deadly. (a) For example, one mutation in a viral gene changed a GAU codon to a GGU codon. How does this change affect the sequence of the polypeptide encoded by that gene? (b) In another variant form of the virus, a gene is missing six consecutive nucleotides. How would this change affect the sequence of the polypeptide encoded by that gene? (c) In another coronavirus variant, the spike protein (the prominent protein on the surface of the virus) contains a histidine residue where an aspartate (aspartic acid) residue should be. Describe a point mutation in the coronavirus genome that could have caused this change in the spike protein.arrow_forwardWhat is the complementary strand of TTGACAGTAAAA?arrow_forward
- Explain what is TFIID ?arrow_forwardWhat do x-helices and B-sheets have in common? Jay A) The length of the 10-amino acid x-Helix and B-sheet strand will be the same. OB) Both are stabilized by glycine and proline residues. C) Both are stabilized by hydrogen bonding involving carbonyl oxygens and amide nitrogens. OD) The same amino acids stabilize both forms of secondary structure.arrow_forwardWhat is Barchyury protein? What is the structural aspects of DNA binding of Barchyury?arrow_forward
- 6. Given: 3"--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is the sequence of amino acids in the protein coded by the MRNA? c) If the first G is substituted by A, what is the sequence of amino acids in the protein? d) What type of mutation is illustrated by (e)?arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardWhat is another name for penicillin binding protein?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning