Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 2AQ
Replication of both strands of DNA in adenoviruses occurs in a continuous (leading) fashion. How can this happen without violating the rule that DNA synthesis always occurs in a 5′ → 3′direction?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Inhibiting the reverse transcriptase of HIV is a common method for treating HIV infections.
a)
The HIV reverse transcriptase has two separate functional domains. One domain has polymerase
activity. What type of activity do you think the other domain would have?
Deamination of cytosine to form uracil can happen spontaneously during replication. It can be repaired relatively easily by
photoreactivation repair using DNA polymerase I
b)
base excision repair using DNA glycosylase creating an AP site
c)
base excision repair using topoisomerase creating an AP site
d)
none of these
Researchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking for versions of the virus that might be more easily transmitted between humans or that might be more deadly.
(a) For example, one mutation in a viral gene changed a GAU codon to a GGU codon. How does this change affect the sequence of the polypeptide encoded by that gene?
(b) In another variant form of the virus, a gene is missing six consecutive nucleotides. How would this change affect the sequence of the polypeptide encoded by that gene?
(c) In another coronavirus variant, the spike protein (the prominent protein on the surface of the virus) contains a histidine residue where an aspartate (aspartic acid) residue should be. Describe a point mutation in the coronavirus genome that could have caused this change in the spike protein.
Chapter 9 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 9.1 - Distinguish between a positive-strand RNA virus...Ch. 9.1 - Prob. 2MQCh. 9.1 - Prob. 3MQCh. 9.2 - Prob. 1MQCh. 9.2 - Prob. 2MQCh. 9.2 - Prob. 3MQCh. 9.3 - Prob. 1MQCh. 9.3 - In the X174 genome, describe the difference...Ch. 9.3 - Prob. 3MQCh. 9.4 - In what major way does transcription of phage DNA...
Ch. 9.4 - Prob. 2MQCh. 9.5 - What type of genome is seen in most archaeal...Ch. 9.5 - Compared with other archaeal viruses, what are two...Ch. 9.6 - Prob. 1MQCh. 9.6 - Prob. 2MQCh. 9.6 - Prob. 3MQCh. 9.7 - Prob. 1MQCh. 9.7 - Prob. 2MQCh. 9.7 - Prob. 3MQCh. 9.8 - Prob. 1MQCh. 9.8 - Prob. 2MQCh. 9.8 - How are protein synthesis and genomic replication...Ch. 9.9 - Prob. 1MQCh. 9.9 - Prob. 2MQCh. 9.9 - Prob. 3MQCh. 9.10 - Prob. 1MQCh. 9.10 - Prob. 2MQCh. 9.10 - Prob. 3MQCh. 9.11 - Prob. 1MQCh. 9.11 - Prob. 2MQCh. 9.11 - How does the role of reverse transcriptase in the...Ch. 9.12 - If viroids are circular molecules, why are they...Ch. 9.12 - Prob. 2MQCh. 9.13 - Prob. 1MQCh. 9.13 - Prob. 2MQCh. 9.13 - Prob. 3MQCh. 9 - Prob. 1RQCh. 9 - Describe the classes of viruses based on their...Ch. 9 - REVIEW QUESTIONS
3. How might viruses help...Ch. 9 - Prob. 4RQCh. 9 - Describe how the genome of bacteriophage X174 is...Ch. 9 - Why can it be said that transcription of the...Ch. 9 - Prob. 7RQCh. 9 - Prob. 8RQCh. 9 - Prob. 9RQCh. 9 - Prob. 10RQCh. 9 - Prob. 11RQCh. 9 - Prob. 12RQCh. 9 - Prob. 13RQCh. 9 - Prob. 14RQCh. 9 - Rabies virus and poliovirus both have...Ch. 9 - Prob. 16RQCh. 9 - Why do both hepadnaviruses and retroviruses...Ch. 9 - Prob. 18RQCh. 9 - What are the similarities and differences between...Ch. 9 - Prob. 20RQCh. 9 - Not all proteins are made from the RNA genome of...Ch. 9 - Replication of both strands of DNA in adenoviruses...Ch. 9 - Imagine that you are a researcher at a...Ch. 9 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Figure 1 above shows that remdesivir “mimics” an important component of RNA replication. Which component of RNA replication has a structure similar to that of remdesivir?arrow_forwardA gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.arrow_forwardIt was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5 viral genes begins with 5’ GGGUACAUGGUAGCC …. 3’, the starting amino sequence is a) N-terminal Gly-Tyr-Met-Val-Ala- C-terminal b) N-terminal Pro-Met-Tyr-His-Arg- C-terminal c) N-terminal Val-Ala- C-terminal d) N-terminal Tyr-His-Arg- C-terminal e) N-terminal Met-Tyr-His-Arg- C-terminalarrow_forward
- If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardAs stated in the text, bacteriophages have been discovered with the following base substitutions in their DNA: (a) dUMP completely substituting for 'TMP (b) 5-hydroxymethyl-dUMP completely substituting for d'TMP (c) 5-methyl-dCMP completely substituting for dCMP For any one of these cases, formulate a set of virus-coded enzyme activities that could lead to the observed substitution. Write a balanced equation for each reaction you propose.arrow_forwardThe following sequence represents a few codons present in one strand of DNA.Using this strand of DNA as a template strand for transcription, you are required to synthesize a new RNA strand. A) Show the codons that will be present on the RNA strand. B) Using the universal genetic code, provide the amino acids on the protein that will be translated from the RNA strand. 3’ TAC ATG GTT GTG CTA ATT 5’arrow_forward
- Both cytosines in the top strand of the following sequence are converted from the 'keto' tautomer to the 'imino' tautomer, resulting in pairing with adenine. (top strand) (bottom strand) After a few rounds of replication, what will the sequence of the mutated bottom strand be? (5' to 3') (Newly incorporated nucleotides are in the 'keto' form.) 5' TAGCATGCAA 3' 3' ATCGTACGTT 5'arrow_forwardIf the MJ helix in bacteriophage MS-2 is replaced with all Adenines on both strands, what would you expect the phenotype of the mutated virus to be?arrow_forwardThe characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the ability of RNA polymerase to match the shape of and the charges of the DNA monomers to the complementary mRNA nucleotide monomers, b) the ability of RNA polymerase to match the shape of and the charges of the DNA monomers to the anti-codons of tRNA, c) The interaction with the cell membrane, d) All of these e) None of these are correctarrow_forward
- Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example: Rifamycin inhibits prokaryotic RNA polymerase Chloramphenicol blocks the transfer of the peptide from the P to A site. a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible. b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)arrow_forwardMolnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA double helix molnupiravir can base pair with more than one base. Shown below are the structures the RNA bases. With which two bases does molnupiravir pair? H N-H Adenine NH-N Uracil H H-N N-HN N-H Guanine H Cytosine A. The "imino" form pairs with A; the "amino" form pairs with G. B. The "imino" form pairs with G; the "amino" form pairs with A. C. The "imino" form pairs with U; the "amino" form pairs with C. D. The "imino" form pairs with C, the "amino" form pairs with U.arrow_forwardIn bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage l is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY