Microbiology with Diseases by Body System (4th Edition)
4th Edition
ISBN: 9780321918550
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 7, Problem 9MC
The Ames test ___________.
- a. uses auxotrophs and liver extract to reveal mutagens
- b. is time intensive and costly
- c. involves the isolation of a mutant by eliminating wild-type
phenotypes with specific media - d. proves that suspected chemicals are carcinogenic
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A cell in this stage of cancer no longer makes the set of proteins that is was originally instructed to make but has not migrated into surrounding tissues; thus at this stage a tissue specific protein production profile could be used to identify a cancer.
a. carcinoma, in situ
b. dysplasia
c. hyperplasia
d. malignant tumor
Please explain right answer
_____ can correct a genetic defect in an individual. a. Cloning vectors c. Sequencing b. Gene therapy d. Electrophoresis
Chapter 7 Solutions
Microbiology with Diseases by Body System (4th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - Prob. 1CTCh. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Definition of Terms( This is all about Applications of Recombinant DNA){ 2-3 sentences only) a. Clone b. Plasmids c. Biotechnology a. PCR Amplification b. Detection c. Modified Trait d. Human Genome e. Genetic Modified Organismarrow_forward4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA. A.Adenovirus DNA hybridization B.Complementation C.Mutagenesis D.Sequencing 1 分 5 In 1998 Fire, Mellow and coworkers discovered that in C. elgans: A.long double-stranded RNAs can cause sequence-specific gene silencing B.short single-stranded RNAs can cause nonspecific gene silencing C.double-stranded RNAs of any length can cause nonspecific gene silencing D.long single-stranded RNAs can cause sequence-specific gene silencing 1 分 6 RNAi seldomly spreads to: A.the neurons B.the liver C.the brain D.the heartarrow_forwardIdentifying an individual by his or her DNA is referred to as ____. a. RNA profiling b. genomic fingerprinting c. individual genomics d. DNA profiling e. structural genomicsarrow_forward
- What technique can be used for studying the gene for cystic fibrosis? a. cellular cloning b. molecular cloning c. reproductive cloningarrow_forwardQuestion 2 The discovery of the DNA structure started the modern era of biotechnology. A) True B Falsearrow_forward_____________ are sequences of identical DNA when it's read from the 5' to 3' direction on one strand and the 5' to 3' direction on the other strand. a. Palindromes b. snRNPs c. RFLPs d. Restriction fragments e. Restriction endonucleasesarrow_forward
- Look at the amino acid chart below that the proctor placed on a board at the front of the classroom before asking the students questions. Help Arcel characterize the DNA mutation (HbS) according to its amino acid and position. a The disease is caused by GAG20→GTG20. b The disease is caused by val6→gln6. c The disease is caused by glu6→ val6. d The disease is caused by glu20→ val20.arrow_forwardDrug-resistant populations of microbes arise when __________________________. Group of answer choices a. exposure to drugs causes mutations in bacterial genes. b. exposure to drugs selectively kills sensitive cells, allowing overgrowth of resistant cells. c. exposure to drugs alters gene expression in bacteria. d. synergy between medications occurs. e. the patient becomes immune to the drug.arrow_forwardIn _____________, a bacteriophage may accidentally package random bacterial DNA and move it into a new recipient bacterial cell. Select one: a.conjugation b.transduction c.transcription d.transformation e.replicationarrow_forward
- which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardThere are two tubes: tube 1 and tube 2. They contain the same DNA sample but different concentration isolated from corn chips in a local restaurant. Tube 1 sample has a Ct value of 10 and tube 2 sample has a Ct value of 20. a. Which tube has a higher starting quantity, tube 1 or tube 2? b. The starting quantity in tube 1 is ________(enter a numerical number) fold (choose one: higher or lower) than that of tube 2.arrow_forwardQUESTION 2 Correctly match the material/supply to its role (job) in genetic engineering. - v cuts gene and recipient DNA leaving sticky ends A. restriction enzyme v moves newly combined DNA from a test tube into the organism B. host - v living thing that gets a new gene and therefore a new trait C. vector |- vglues the new gene and recipient DNA together D. DNA ligasearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Bacterial Infections in Humans; Author: Professor Dave Explains;https://www.youtube.com/watch?v=FeFKAl9KyMg;License: Standard Youtube License