Microbiology with Diseases by Body System (4th Edition)
4th Edition
ISBN: 9780321918550
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 3CT
Explain why an insertion of three nucleotides is less likely to result in a deleterious effect than an insertion of a single
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Give 3 strand slippage and trinucleotide repeat disorder examples
Describe three outcomes of base substitutions.
What would the effect be if there was a substitution of one nucleotide for another?
Chapter 7 Solutions
Microbiology with Diseases by Body System (4th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - Prob. 1CTCh. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardExplain why indels that involve just one or two nucleotides have more severe consequences than indels that involve three contiguous nucleotides.arrow_forwardAn addition or deletion mutation that results in all of the amino acids after the mutation being wrong is calledarrow_forward
- Describe the synthesis of oligonucleotide primers.arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'arrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Glarrow_forward
- Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…arrow_forwardUsing sickle cell as an example, give a detailed description of how the effects of a base substitution can be traced from DNA level to the level of the whole organism.arrow_forwardMolnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA double helix molnupiravir can base pair with more than one base. Shown below are the structures the RNA bases. With which two bases does molnupiravir pair? H N-H Adenine NH-N Uracil H H-N N-HN N-H Guanine H Cytosine A. The "imino" form pairs with A; the "amino" form pairs with G. B. The "imino" form pairs with G; the "amino" form pairs with A. C. The "imino" form pairs with U; the "amino" form pairs with C. D. The "imino" form pairs with C, the "amino" form pairs with U.arrow_forward
- While there is a T nucleotide in one position in one of the double chains, if there is a G nucleotide opposite this nucleotide in the complementary chain; Does this pose a problem? If you think it will cause a problem, explain what kind of problem it may create. What repair systems might work to fix this problem? Briefly describe the operation of these systems.arrow_forwardUse the identity of the drug target to find the nucleic acid sequence of the gene that encodes the drug target. (Be careful; do you need to find genomic sequence, a CDNA sequence or an MRNA sequence?). Identify the start and stop codons.arrow_forwardProcedure: Refer to the Genetic Code Table below to identify the right amino acid coded. To determine the order of bases in the first column (uNA), second column (codon) and the third column is the anticodon. Consider the complementary base pair in DNA and in RNA To identify the amino acid, took at the bases in the MRNA codon, example AUG using the Genetic Code Table. Lool: for the first letter of the MRNA codon on the left side of the genstic code table (A), the second letter of the MRNA on the second letter column (U), and the third letter on the right-side column (G). AUG codes for the amino acid -methionine, Do the same with the other codons in the chart. Genetic Code Table 2nd posttion of codon UUU Phe Phenylalanine UCU Ser S Serine Phenylalanine UC C Ser S Serine UCA Ser S Serine UCe Ser S Serine CCU Pra P Proline UAU Tyr Y Tyrosine UAC Tyr Y Tyrosine UGU Cys C ysteine UGC Cys C Cysteine UUC Phe F UUA Lau UUG Leu CUU Leu CUC CUA Leucine UGA UGG Trp W Tryptophan G stop stop L…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY