Microbiology with Diseases by Body System (4th Edition)
4th Edition
ISBN: 9780321918550
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 6MC
Which of the following molecules functions as a “proofreader” for a newly replicated strand of DNA?
- a. DNA polymerase III
- b. primase
- c. helicase
- d. ligase
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which statement about Okazaki fragments is true?
Select one:
a. DNA polymerase doesn’t need a primer to build these fragments
b. They act as a primer that initiates DNA replication.
c. They correct errors made during earlier phases of DNA replication.
d. They are necessary because DNA polymerase can only build DNA in the 5’ to 3’ direction, so for one of the strands at each fork, the DNA polymerase can only buildaway from the fork.
e. They prevent the ends of chromosomes from shortening with every replication.
Which of the following molecules helps relieve the tension of unwinding parental DNA strands, by breaking DNA and rejoining it before it is replicated?
a.
Primase
b.
Single-stranded binding proteins
c.
Helicase
d.
Topoisomerase
For the statements below, indicate whether the statement applies to the leading strand, or to the lagging strand, or to both.
a. synthesized in the 5'→3' direction
b. synthesized continuously
c. require(s) DNA ligase to join fragments
d. described as a daughter strand
e. synthesized in the same direction as the movement of the replication fork
f. DNA polymerase is the enzyme involved in forming this polynucleotide.
Chapter 7 Solutions
Microbiology with Diseases by Body System (4th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - Prob. 1CTCh. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA Polymerase holoenzymes used for DNA replication recognizes A. double-stranded sequences as starting points B. methylated lipids as start points C. acetylated lipids as start points D. single stranded sequences as starting pointsarrow_forwardDuring DNA replication, the Okazaki fragments are Select one: O a. single-strand RNA O b. RNA-DNA hybrid C. double-strand DNA O c. O d. single-stranded DNAarrow_forwardMatch the enzymes provided from (1-4) in the list of choices with their matching function (A-D) during DNA replication. A. Disrupts hydrogen bonds between DNA bases B. Can only add nucleotides to an existing 3 OH end C. Can't add nucleotides to a chain, but can make covalent bonds D. Actually a specialized form of RNA polymerase select 1. DNA polymerase select 2. Primase select 3. Ligase select v 4. Helicasearrow_forward
- Semiconservative replication of DNA means that: a. both daughter duplexes will be entirely new and the parental duplex will be degraded b. each daughter duplex will have one of the original parental strands and one new strand c. each strand of the daughter duplexes will have parts of the parental strand and parts of the new strand d. one daughter duplex will be entirely new and the other will have both original parental strandsarrow_forwardWhich one is correct?arrow_forwarda. unwinds the DNA helix b. stabilizes and stops the two strands from annealing (rebinding with each other) c. recoils the DNA d. cleaves both strands of DNA to relieve tension at supercoils e. places RNA primers at their proper location on the template strands f. acts as starting points for DNA polymerase g. adds DNA nucleotides to form new DNA strands h. forms phosphodiester bonds to join Okazaki fragments Esc 1. single-strand binding protein 2. helicase 3. DNA ligase 4. RNA primer 5. gyrase 6. DNA polymerase 53°F Cloudy 3 Q Search $ F5 FRarrow_forward
- Which of the following statements is TRUE concerning the synthesis of the leading and lagging strands of DNA in prokaryotic cells? a. O b. The leading strand is synthesized by one polymerase III continuously, and the lagging strand is synthesized by several molecules of DNA polymerase III. d. The leading and lagging strands are synthesized at the same time by the one DNA polymerase I. O c. The leading and lagging strands are synthesized at the same time by the one DNA polymerase III. The leading strand is synthesized by one polymerase III, and the lagging strand is synthesized by DNA polymerase I.arrow_forwardThe enzyme responsible for the joining of Okazaki fragments is a. helicase b. primase c. DNA ligase d. DNA topoisomerasearrow_forwardTake each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forward
- Strand invasion is often used to repair which of the following damages to DNA? a. Single-strand breaks b. Double-strand breaks. c. Mismatched bases d. Thymine dimers.arrow_forwardDNA damage by uv light creates pyrimidine dimers between adjacent pyrimidines on the same strand. The cellular mechanism used to repair these dimers is : A. Mismatch repair B. Proofreading C. Nucleotide Excision Repair D. Single- base excisionarrow_forwardThe function of DNA ligase is to: a. Catalyze formation of phosphodiester bonds between adjacent nucleotides b. Catalyze formation of hydrogen bonds between adjacent nucleotides c. Keep single strands of DNA apart during replication d. Facilitate base pairing between single stranded molecules in DNA e. Both a. and d. are correctarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY