
Anatomy & Physiology: The Unity of Form and Function
8th Edition
ISBN: 9781259277726
Author: Kenneth S. Saladin Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 13TYR
Summary Introduction
Introduction:
Growth of an individual depends on cartilage growth and this process is called ossification. Calcium is a mineral necessary for the bone development. In ossification, calcium and phosphate accumulate on cartilage. Bone grows longer through the bone tissue this occurs at epiphyseal plate also called as growth plate. A chondrocyte is a first hyaline cartilage occurs during growth process where excess bones are taken away as unwanted tissue through osteoclast. Ossification helps to grow and remodel bones on two directions (length and width).
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 7 Solutions
Anatomy & Physiology: The Unity of Form and Function
Ch. 7.1 - Name at least five tissues found in a boneCh. 7.1 - Prob. 2BYGOCh. 7.1 - Prob. 3BYGOCh. 7.1 - Prob. 4BYGOCh. 7.1 - The branch of medicine and biology that deals with...Ch. 7.1 - Prob. 2AYLOCh. 7.1 - Prob. 3AYLOCh. 7.1 - Prob. 4AYLOCh. 7.1 - Prob. 5AYLOCh. 7.1 - Other anatomical features of a long bone including...
Ch. 7.1 - Prob. 7AYLOCh. 7.2 - Suppose you had unlabeled electron micrographs of...Ch. 7.2 - Name three organic components of the bone matrix.Ch. 7.2 - What are the mineral crystals of bone called, and...Ch. 7.2 - Sketch a cross section of an osteon and label its...Ch. 7.2 - Prob. 9BYGOCh. 7.2 - Histology of Osseous Tissue 1. The four cell type...Ch. 7.2 - Organic and inorganic components of the bone...Ch. 7.2 - Osteon structure and the relationship of osteonic...Ch. 7.2 - The route by which nerves and blood vessels...Ch. 7.2 - Prob. 5AYLOCh. 7.2 - Prob. 6AYLOCh. 7.3 - Describe the stages of intramembranous...Ch. 7.3 - Describe how a cartilage model is transformed into...Ch. 7.3 - Prob. 12BYGOCh. 7.3 - Prob. 13BYGOCh. 7.3 - Stages of intramembranous ossification; some bones...Ch. 7.3 - Prob. 2AYLOCh. 7.3 - Prob. 3AYLOCh. 7.3 - How stresses on bones remodel item throughout...Ch. 7.4 - Prob. 14BYGOCh. 7.4 - Prob. 15BYGOCh. 7.4 - Prob. 16BYGOCh. 7.4 - Prob. 17BYGOCh. 7.4 - Prob. 1AYLOCh. 7.4 - Prob. 2AYLOCh. 7.4 - Prob. 3AYLOCh. 7.4 - The role of the skeleton as a calcium reservoir in...Ch. 7.4 - Prob. 5AYLOCh. 7.4 - Prob. 6AYLOCh. 7.4 - Prob. 7AYLOCh. 7.4 - Prob. 8AYLOCh. 7.4 - Prob. 9AYLOCh. 7.4 - Prob. 10AYLOCh. 7.5 - Prob. 18BYGOCh. 7.5 - Prob. 19BYGOCh. 7.5 - Prob. 20BYGOCh. 7.5 - Prob. 1AYLOCh. 7.5 - Causes of osteoporosis: its risk factor,...Ch. 7 - Which cells have a ruffled border and secrete...Ch. 7 - Prob. 2TYRCh. 7 - Prob. 3TYRCh. 7 - Osteoclasts are most closely related, by common...Ch. 7 - The walls between cartilage lacunae break down in...Ch. 7 - Which of these is not an effect of PTH? a. rise in...Ch. 7 - Prob. 7TYRCh. 7 - One long bone meets another at its a. diaphysis....Ch. 7 - Calcitriol is made from a. calcitonin. b....Ch. 7 - One sign of osteoporosis is a. osteosarcoma. b....Ch. 7 - Calcium phosphate crystallizes in bone as a...Ch. 7 - Prob. 12TYRCh. 7 - Prob. 13TYRCh. 7 - Prob. 14TYRCh. 7 - Prob. 15TYRCh. 7 - Prob. 16TYRCh. 7 - Prob. 17TYRCh. 7 - Prob. 18TYRCh. 7 - Prob. 19TYRCh. 7 - Prob. 20TYRCh. 7 - Prob. 1BYMVCh. 7 - Prob. 2BYMVCh. 7 - Prob. 3BYMVCh. 7 - Prob. 4BYMVCh. 7 - ortho-Ch. 7 - Prob. 6BYMVCh. 7 - Prob. 7BYMVCh. 7 - Prob. 8BYMVCh. 7 - spic-Ch. 7 - topo-Ch. 7 - Prob. 1WWTSCh. 7 - Prob. 2WWTSCh. 7 - Prob. 3WWTSCh. 7 - The growth zone of the lone bones of adolescents...Ch. 7 - Prob. 5WWTSCh. 7 - Prob. 6WWTSCh. 7 - Whats Wrong with These Statements? 7. The protein...Ch. 7 - Prob. 8WWTSCh. 7 - Prob. 9WWTSCh. 7 - Prob. 10WWTSCh. 7 - Most osteocytes of an osteon are far removed from...Ch. 7 - Prob. 2TYCCh. 7 - How does the regulation of blood calcium...Ch. 7 - Describe how the arrangement of trabeculae in...Ch. 7 - Identify two bone diseases you would expect to see...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Dissection Basics | Types and Tools; Author: BlueLink: University of Michigan Anatomy;https://www.youtube.com/watch?v=-_B17pTmzto;License: Standard youtube license