Anatomy & Physiology: The Unity of Form and Function
8th Edition
ISBN: 9781259277726
Author: Kenneth S. Saladin Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 2TYR
Summary Introduction
Introduction:
In mammals, blood formation takes place in hematopoietic cells present in bone marrow. In adults, it is found in flat bone like sternum and pelvic girdle. In children, bone marrow is found in the medullary cavity of bone called femur, and yellow bone marrow is responsible for fat storage.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 7 Solutions
Anatomy & Physiology: The Unity of Form and Function
Ch. 7.1 - Name at least five tissues found in a boneCh. 7.1 - Prob. 2BYGOCh. 7.1 - Prob. 3BYGOCh. 7.1 - Prob. 4BYGOCh. 7.1 - The branch of medicine and biology that deals with...Ch. 7.1 - Prob. 2AYLOCh. 7.1 - Prob. 3AYLOCh. 7.1 - Prob. 4AYLOCh. 7.1 - Prob. 5AYLOCh. 7.1 - Other anatomical features of a long bone including...
Ch. 7.1 - Prob. 7AYLOCh. 7.2 - Suppose you had unlabeled electron micrographs of...Ch. 7.2 - Name three organic components of the bone matrix.Ch. 7.2 - What are the mineral crystals of bone called, and...Ch. 7.2 - Sketch a cross section of an osteon and label its...Ch. 7.2 - Prob. 9BYGOCh. 7.2 - Histology of Osseous Tissue 1. The four cell type...Ch. 7.2 - Organic and inorganic components of the bone...Ch. 7.2 - Osteon structure and the relationship of osteonic...Ch. 7.2 - The route by which nerves and blood vessels...Ch. 7.2 - Prob. 5AYLOCh. 7.2 - Prob. 6AYLOCh. 7.3 - Describe the stages of intramembranous...Ch. 7.3 - Describe how a cartilage model is transformed into...Ch. 7.3 - Prob. 12BYGOCh. 7.3 - Prob. 13BYGOCh. 7.3 - Stages of intramembranous ossification; some bones...Ch. 7.3 - Prob. 2AYLOCh. 7.3 - Prob. 3AYLOCh. 7.3 - How stresses on bones remodel item throughout...Ch. 7.4 - Prob. 14BYGOCh. 7.4 - Prob. 15BYGOCh. 7.4 - Prob. 16BYGOCh. 7.4 - Prob. 17BYGOCh. 7.4 - Prob. 1AYLOCh. 7.4 - Prob. 2AYLOCh. 7.4 - Prob. 3AYLOCh. 7.4 - The role of the skeleton as a calcium reservoir in...Ch. 7.4 - Prob. 5AYLOCh. 7.4 - Prob. 6AYLOCh. 7.4 - Prob. 7AYLOCh. 7.4 - Prob. 8AYLOCh. 7.4 - Prob. 9AYLOCh. 7.4 - Prob. 10AYLOCh. 7.5 - Prob. 18BYGOCh. 7.5 - Prob. 19BYGOCh. 7.5 - Prob. 20BYGOCh. 7.5 - Prob. 1AYLOCh. 7.5 - Causes of osteoporosis: its risk factor,...Ch. 7 - Which cells have a ruffled border and secrete...Ch. 7 - Prob. 2TYRCh. 7 - Prob. 3TYRCh. 7 - Osteoclasts are most closely related, by common...Ch. 7 - The walls between cartilage lacunae break down in...Ch. 7 - Which of these is not an effect of PTH? a. rise in...Ch. 7 - Prob. 7TYRCh. 7 - One long bone meets another at its a. diaphysis....Ch. 7 - Calcitriol is made from a. calcitonin. b....Ch. 7 - One sign of osteoporosis is a. osteosarcoma. b....Ch. 7 - Calcium phosphate crystallizes in bone as a...Ch. 7 - Prob. 12TYRCh. 7 - Prob. 13TYRCh. 7 - Prob. 14TYRCh. 7 - Prob. 15TYRCh. 7 - Prob. 16TYRCh. 7 - Prob. 17TYRCh. 7 - Prob. 18TYRCh. 7 - Prob. 19TYRCh. 7 - Prob. 20TYRCh. 7 - Prob. 1BYMVCh. 7 - Prob. 2BYMVCh. 7 - Prob. 3BYMVCh. 7 - Prob. 4BYMVCh. 7 - ortho-Ch. 7 - Prob. 6BYMVCh. 7 - Prob. 7BYMVCh. 7 - Prob. 8BYMVCh. 7 - spic-Ch. 7 - topo-Ch. 7 - Prob. 1WWTSCh. 7 - Prob. 2WWTSCh. 7 - Prob. 3WWTSCh. 7 - The growth zone of the lone bones of adolescents...Ch. 7 - Prob. 5WWTSCh. 7 - Prob. 6WWTSCh. 7 - Whats Wrong with These Statements? 7. The protein...Ch. 7 - Prob. 8WWTSCh. 7 - Prob. 9WWTSCh. 7 - Prob. 10WWTSCh. 7 - Most osteocytes of an osteon are far removed from...Ch. 7 - Prob. 2TYCCh. 7 - How does the regulation of blood calcium...Ch. 7 - Describe how the arrangement of trabeculae in...Ch. 7 - Identify two bone diseases you would expect to see...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning