
Human Anatomy & Physiology
1st Edition
ISBN: 9780805382952
Author: Erin C. Amerman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 5.5, Problem 3QC
Summary Introduction
To review:
The factors that influence the hair color and texture.
Introduction:
The hair are present on almost all the regions of the body. Some of these body hair are soft while some have a coarse presentation. Some hair are darker inshade while some are faint in color. There are several factors that differentiate the color and texture of the hair.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 5 Solutions
Human Anatomy & Physiology
Ch. 5.1 - 1. What are the major structures of the skin, and...Ch. 5.1 - Explain how the integument provides protection...Ch. 5.1 - Prob. 3QCCh. 5.1 - Describe the other functions of the integument....Ch. 5.2 - 1. What are the five strata of the epidermis? How...Ch. 5.2 - Explain how a keratinocyte that begins its life in...Ch. 5.2 - In addition to keratinocytes, what three types of...Ch. 5.2 - Compare and contrast thin and thick skin.Ch. 5.3 - Which type of tissue makes up the papillary layer...Ch. 5.3 - What are the functions of the dermal papillae?
Ch. 5.3 - 3. Which type of tissue makes up the reticular...Ch. 5.3 - 4. What other structures are located in the...Ch. 5.3 - 5. How does the papillary layer of the dermis...Ch. 5.3 - What causes tension lines and flexure lines? How...Ch. 5.4 - How is melanin produced, and how does it interact...Ch. 5.4 - What are the functions of melanin?Ch. 5.4 - 3. What is carotene, and what color does it give...Ch. 5.4 - Prob. 4QCCh. 5.4 - 5. How can the oxygen content of the blood affect...Ch. 5.4 - 6. What is cyanosis, and what can it tell us...Ch. 5.5 - How do the hair shaft and hair root differ?Ch. 5.5 - How does a hair grow in length?Ch. 5.5 - Prob. 3QCCh. 5.5 - Define the following terms: nail bed, nail plate,...Ch. 5.5 - How does nail growth occur?Ch. 5.5 - Prob. 6QCCh. 5.5 - What are the other three types of sweat glands,...Ch. 5.5 - 8. How do sebaceous glands and sebum differ from...Ch. 5.6 - Prob. 1QCCh. 5.6 - Prob. 2QCCh. 5.6 - What is cancer?Ch. 5.6 - 4. How do the three types of skin cancer differ?
Ch. 5 - Explain why the skin is an organ.Ch. 5 - Which of the following correctly describes the...Ch. 5 - Which of the following is not a function of the...Ch. 5 - 4. Explain what happens to dermal blood vessels...Ch. 5 - Number the strata of thick skin epidermis from...Ch. 5 - Keratinocytes in the superficial strata of the...Ch. 5 - Mark the following statements as true or false. If...Ch. 5 - Which of the following statements is false? a....Ch. 5 - What are the functions of the dermal papillae?Ch. 5 - Epidermal ridges are created by: a. the epidermal...Ch. 5 - 11. Mark the following statements as true or...Ch. 5 - 12. Which of the following is not a function of...Ch. 5 - 13. Fill in the blanks: The portion of the hair...Ch. 5 - Nail growth occurs when: a. cells in the nail...Ch. 5 - Prob. 15CYRCh. 5 - Match each type of gland with its correct...Ch. 5 - How do sweat and sebum differ?Ch. 5 - 18. Which type of burn involves the epidermis and...Ch. 5 - 19. The type of skin tumor that involves the...Ch. 5 - Prob. 1CYUCh. 5 - Prob. 2CYUCh. 5 - The hair and nails are sometimes called accessory...Ch. 5 - 1. You are working in the emergency department...Ch. 5 - 2. After Ramon’s skin came into contact with a...Ch. 5 - 3. Which of the following is not a function of...Ch. 5 - 4. What would happen to the skin if the oil...Ch. 5 - Many antiaging skin creams contain collagen and...Ch. 5 - 6. Would a mild second-degree burn be likely to...
Knowledge Booster
Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeNutrition Through The Life CycleHealth & NutritionISBN:9781337919333Author:Brown, Judith E.Publisher:Cengage Learning,

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Nutrition Through The Life Cycle
Health & Nutrition
ISBN:9781337919333
Author:Brown, Judith E.
Publisher:Cengage Learning,