ANATOMY+PHYSIOLOGY
4th Edition
ISBN: 9781260265217
Author: McKinley
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 5.1, Problem 2WDYL
Why is an epithelium considered selectively permeable?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 5 Solutions
ANATOMY+PHYSIOLOGY
Ch. 5.1 - Why does an epithelium need to be highly...Ch. 5.1 - Why is an epithelium considered selectively...Ch. 5.1 - Prob. 3WDYLCh. 5.1 - Prob. 4WDYLCh. 5.1 - Prob. 5WDYLCh. 5.1 - What are the two basic parts of a multicellular...Ch. 5.1 - What are the differences between holocrine and...Ch. 5.2 - What are the basic functional differences between...Ch. 5.2 - Prob. 9WDYLCh. 5.2 - Prob. 10WDYL
Ch. 5.2 - Prob. 11WDYLCh. 5.2 - Prob. 12WDYLCh. 5.2 - Describe the composition and location of...Ch. 5.2 - Why is blood considered a connective tissue?Ch. 5.3 - Compare and contrast the structure of skeletal and...Ch. 5.4 - What is the difference between a neuron and a...Ch. 5.5 - Prob. 17WDYLCh. 5.5 - What are the differences between the parietal and...Ch. 5.6 - What are the three primary germ layers, and when...Ch. 5.6 - What is the difference between metaplasia,...Ch. 5.6 - How do epithelia and connective tissue change when...Ch. 5 - ____ 1. Which tissue contains a calcified ground...Ch. 5 - Which of the following is a characteristic of...Ch. 5 - ____ 3. __________ membranes line body cavities...Ch. 5 - ____ 4. Which of the following is a correct...Ch. 5 - ____ 5. All of the following are characteristics...Ch. 5 - Prob. 6DYKBCh. 5 - ____ 7. Which tissue type is formed from mesoderm?...Ch. 5 - ____ 8. Which muscle type consists of long,...Ch. 5 - ____ 9. Which epithelial tissue type lines the...Ch. 5 - ____ 10. A gland that releases its secretion by...Ch. 5 - What are some characteristics of all types of...Ch. 5 - Describe the two main criteria by which epithelia...Ch. 5 - Prob. 13DYKBCh. 5 - Prob. 14DYKBCh. 5 - Name the four types of body membranes, and cite a...Ch. 5 - What characteristics are common to all connective...Ch. 5 - What are the main structural differences between...Ch. 5 - In what regions of the body would you expect to...Ch. 5 - What are the similarities and differences between...Ch. 5 - What is the difference between neurons and glial...Ch. 5 - John is a 53-year-old construction worker who has...Ch. 5 - Your optometrist shines a light in your eye and...Ch. 5 - During a biology lab, Erin used a cotton swab to...Ch. 5 - During a biology lab, Erin used a cotton swab to...Ch. 5 - During a biology lab, Erin used a cotton swab to...Ch. 5 - Prob. 1CSLCh. 5 - Your father is suffering from a painful knee...Ch. 5 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Types of Human Body Tissue; Author: MooMooMath and Science;https://www.youtube.com/watch?v=O0ZvbPak4ck;License: Standard YouTube License, CC-BY