
(a)
Interpretation:
Concept Introduction:
Atoms are made up of even smaller particles. These particles are very small and these are all the building blocks of atoms and they are known as subatomic particles. Protons, electrons, and neutrons are the subatomic particles that are found in atom. Electrons possess a negative electrical charge. Protons possess a positive electrical charge. Neutrons possess no charge and they are neutral.
Mass number is the sum of the number of protons and neutrons inside the nucleus of an atom. This gives the number of subatomic particle present inside the nucleus. Mass number is represented by the symbol A.
From atomic number and mass number, the number of each sub atomic particle can be found.
Complete chemical symbol notation can be given as.
An element is a pure substance that cannot be broken by ordinary
(a)

Explanation of Solution
For
The atomic number is given as 7. The element is found to be nitrogen. Mass number given for nitrogen is given as 13. The number of protons present in it is also 7 as atomic number is the number of protons or electrons. Mass number of the sum of protons and neutrons present in the atom.
The number of neutrons can be identified by finding the difference between mass number and atomic number. This gives the number of neutrons to be 6.
The total number of nucleons is same as that of the mass number. This means the total number of nucleons is 13.
The total number of subatomic particle present in the given atom is the sum of mass number and atomic number. This means the total number of subatomic particle is 20.
For
The atomic number is given as 6. The element is found to be carbon. Mass number given for carbon is given as 13. The number of protons present in it is also 6 as atomic number is the number of protons or electrons. Mass number of the sum of protons and neutrons present in the atom.
The number of neutrons can be identified by finding the difference between mass number and atomic number. This gives the number of neutrons to be 7.
The total number of nucleons is same as that of the mass number. This means the total number of nucleons is 13.
The total number of subatomic particle present in the given atom is the sum of mass number and atomic number. This means the total number of subatomic particle is 19.
On comparing both the pair of atoms it is found that they contain same number of nucleons only.
(b)
Interpretation:
Concept Introduction:
Atoms are made up of even smaller particles. These particles are very small and these are all the building blocks of atoms and they are known as subatomic particles. Protons, electrons, and neutrons are the subatomic particles that are found in atom. Electrons possess a negative electrical charge. Protons possess a positive electrical charge. Neutrons possess no charge and they are neutral.
Atomic number for each and every element is a unique one. This is the total number of protons that is present in an atom. As the atom is electrically neutral, it can also be said that the total number of electrons is the atomic number. Atomic number is represented by the symbol Z.
Mass number is the sum of the number of protons and neutrons inside the nucleus of an atom. This gives the number of subatomic particle present inside the nucleus. Mass number is represented by the symbol A.
From atomic number and mass number, the number of each sub atomic particle can be found.
Complete chemical symbol notation can be given as.
An element is a pure substance that cannot be broken by ordinary chemical reactions into simpler substances. All the atoms in an element will have the same atomic number. The electrons only take part in the chemical reaction while the nucleus does not. Hence, the atomic number (number or protons) does not change and it characterizes an atom.
(b)

Explanation of Solution
For
The atomic number is given as 17. The element is found to be chlorine. Mass number given for chlorine is given as 37. The number of protons present in it is also 17 as atomic number is the number of protons or electrons. Mass number of the sum of protons and neutrons present in the atom.
The number of neutrons can be identified by finding the difference between mass number and atomic number. This gives the number of neutrons to be 20.
The total number of nucleons is same as that of the mass number. This means the total number of nucleons is 37.
The total number of subatomic particle present in the given atom is the sum of mass number and atomic number. This means the total number of subatomic particle is 54.
For
The atomic number is given as 18. The element is found to be argon. Mass number given for argon is given as 36. The number of protons present in it is also 18 as atomic number is the number of protons or electrons. Mass number of the sum of protons and neutrons present in the atom.
The number of neutrons can be identified by finding the difference between mass number and atomic number. This gives the number of neutrons to be 18.
The total number of nucleons is same as that of the mass number. This means the total number of nucleons is 36.
The total number of subatomic particle present in the given atom is the sum of mass number and atomic number. This means the total number of subatomic particle is 54.
On comparing both the pair of atoms it is found that they contain same number of subatomic particles in them.
(c)
Interpretation:
Concept Introduction:
Atoms are made up of even smaller particles. These particles are very small and these are all the building blocks of atoms and they are known as subatomic particles. Protons, electrons, and neutrons are the subatomic particles that are found in atom. Electrons possess a negative electrical charge. Protons possess a positive electrical charge. Neutrons possess no charge and they are neutral.
Atomic number for each and every element is a unique one. This is the total number of protons that is present in an atom. As the atom is electrically neutral, it can also be said that the total number of electrons is the atomic number. Atomic number is represented by the symbol Z.
Mass number is the sum of the number of protons and neutrons inside the nucleus of an atom. This gives the number of subatomic particle present inside the nucleus. Mass number is represented by the symbol A.
From atomic number and mass number, the number of each sub atomic particle can be found.
Complete chemical symbol notation can be given as.
An element is a pure substance that cannot be broken by ordinary chemical reactions into simpler substances. All the atoms in an element will have the same atomic number. The electrons only take part in the chemical reaction while the nucleus does not. Hence, the atomic number (number or protons) does not change and it characterizes an atom.
(c)

Explanation of Solution
For
The atomic number is given as 17. The element is found to be chlorine. Mass number given for chlorine is given as 35. The number of protons present in it is also 17 as atomic number is the number of protons or electrons. Mass number of the sum of protons and neutrons present in the atom.
The number of neutrons can be identified by finding the difference between mass number and atomic number. This gives the number of neutrons to be 18.
The total number of nucleons is same as that of the mass number. This means the total number of nucleons is 35.
The total number of subatomic particle present in the given atom is the sum of mass number and atomic number. This means the total number of subatomic particle is 52.
For
The atomic number is given as 17. The element is found to be chlorine. Mass number given for chlorine is given as 37. The number of protons present in it is also 17 as atomic number is the number of protons or electrons. Mass number of the sum of protons and neutrons present in the atom.
The number of neutrons can be identified by finding the difference between mass number and atomic number. This gives the number of neutrons to be 20.
The total number of nucleons is same as that of the mass number. This means the total number of nucleons is 37.
The total number of subatomic particle present in the given atom is the sum of mass number and atomic number. This means the total number of subatomic particle is 54.
On comparing both the pair of atoms it is found that they contain same number of protons.
(d)
Interpretation:
Concept Introduction:
Atoms are made up of even smaller particles. These particles are very small and these are all the building blocks of atoms and they are known as subatomic particles. Protons, electrons, and neutrons are the subatomic particles that are found in atom. Electrons possess a negative electrical charge. Protons possess a positive electrical charge. Neutrons possess no charge and they are neutral.
Atomic number for each and every element is a unique one. This is the total number of protons that is present in an atom. As the atom is electrically neutral, it can also be said that the total number of electrons is the atomic number. Atomic number is represented by the symbol Z.
Mass number is the sum of the number of protons and neutrons inside the nucleus of an atom. This gives the number of subatomic particle present inside the nucleus. Mass number is represented by the symbol A.
From atomic number and mass number, the number of each sub atomic particle can be found.
Complete chemical symbol notation can be given as.
An element is a pure substance that cannot be broken by ordinary chemical reactions into simpler substances. All the atoms in an element will have the same atomic number. The electrons only take part in the chemical reaction while the nucleus does not. Hence, the atomic number (number or protons) does not change and it characterizes an atom.
(d)

Explanation of Solution
For
The atomic number is given as 8. The element is found to be oxygen. Mass number given for oxygen is given as 18. The number of protons present in it is also 8 as atomic number is the number of protons or electrons. Mass number of the sum of protons and neutrons present in the atom.
The number of neutrons can be identified by finding the difference between mass number and atomic number. This gives the number of neutrons to be 10.
The total number of nucleons is same as that of the mass number. This means the total number of nucleons is 18.
The total number of subatomic particle present in the given atom is the sum of mass number and atomic number. This means the total number of subatomic particle is 26.
For
The atomic number is given as 9. The element is found to be fluorine. Mass number given for fluorine is given as 19. The number of protons present in it is also 17 as atomic number is the number of protons or electrons. Mass number of the sum of protons and neutrons present in the atom.
The number of neutrons can be identified by finding the difference between mass number and atomic number. This gives the number of neutrons to be 10.
The total number of nucleons is same as that of the mass number. This means the total number of nucleons is 19.
The total number of subatomic particle present in the given atom is the sum of mass number and atomic number. This means the total number of subatomic particle is 28.
On comparing both the pair of atoms it is found that they contain same number of neutrons.
Want to see more full solutions like this?
Chapter 3 Solutions
Bundle: General, Organic, and Biological Chemistry, 7th + OWLv2 Quick Prep for General Chemistry, 4 terms (24 months) Printed Access Card
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning




