Anatomy & Physiology: The Unity of Form and Function
8th Edition
ISBN: 9781259277726
Author: Kenneth S. Saladin Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 25, Problem 9WWTS
Summary Introduction
Introduction:
Many digestive enzymes and hormones are secreted in the digestive tract. Secretin, motilin, somatostatin, and gastrin are some of the digestive hormones. Secretin is a peptide hormone produced by the duodenum in response to the acidity of chyme in the stomach. This enzyme inhibits gastric acid secretions and gastrin.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 25 Solutions
Anatomy & Physiology: The Unity of Form and Function
Ch. 25.1 - Prob. 1BYGOCh. 25.1 - Prob. 2BYGOCh. 25.1 - Prob. 3BYGOCh. 25.1 - Prob. 4BYGOCh. 25.1 - Prob. 1AYLOCh. 25.1 - The difference between the digestive tract and the...Ch. 25.1 - Prob. 3AYLOCh. 25.1 - Prob. 4AYLOCh. 25.1 - Prob. 5AYLOCh. 25.1 - Prob. 6AYLO
Ch. 25.2 - Prob. 5BYGOCh. 25.2 - Prob. 6BYGOCh. 25.2 - Prob. 7BYGOCh. 25.2 - Prob. 8BYGOCh. 25.2 - Prob. 9BYGOCh. 25.2 - Seven functions of the oral cavityCh. 25.2 - Prob. 2AYLOCh. 25.2 - Prob. 3AYLOCh. 25.2 - Prob. 4AYLOCh. 25.2 - Anatomy of the hard and soft palates; the two...Ch. 25.2 - Prob. 6AYLOCh. 25.2 - Six functions of saliva; its composition and pH;...Ch. 25.2 - Prob. 8AYLOCh. 25.2 - Prob. 9AYLOCh. 25.2 - The physiology of swallowing; the swallowing...Ch. 25.3 - Prob. 10BYGOCh. 25.3 - Prob. 11BYGOCh. 25.3 - Prob. 12BYGOCh. 25.3 - Prob. 13BYGOCh. 25.3 - Anatomy and functions of the stomach; features...Ch. 25.3 - Prob. 2AYLOCh. 25.3 - Prob. 3AYLOCh. 25.3 - Prob. 4AYLOCh. 25.3 - The cells that secrete hydrochloric acid, how they...Ch. 25.3 - Prob. 6AYLOCh. 25.3 - Prob. 7AYLOCh. 25.3 - Prob. 8AYLOCh. 25.3 - Prob. 9AYLOCh. 25.3 - Prob. 10AYLOCh. 25.3 - Prob. 11AYLOCh. 25.3 - The degree of digestion that occurs in the...Ch. 25.3 - Prob. 13AYLOCh. 25.3 - Prob. 14AYLOCh. 25.4 - Prob. 14BYGOCh. 25.4 - Prob. 15BYGOCh. 25.4 - Prob. 16BYGOCh. 25.4 - Prob. 17BYGOCh. 25.4 - Prob. 1AYLOCh. 25.4 - Prob. 2AYLOCh. 25.4 - Prob. 3AYLOCh. 25.4 - Prob. 4AYLOCh. 25.4 - Prob. 5AYLOCh. 25.4 - Prob. 6AYLOCh. 25.4 - Prob. 7AYLOCh. 25.4 - Composition and digestive functions of pancreatic...Ch. 25.4 - Prob. 9AYLOCh. 25.5 - Prob. 18BYGOCh. 25.5 - Prob. 19BYGOCh. 25.5 - Distinguish between segmentation and the migrating...Ch. 25.5 - Structures that mark the beginning and end of the...Ch. 25.5 - Prob. 2AYLOCh. 25.5 - Prob. 3AYLOCh. 25.5 - Prob. 4AYLOCh. 25.5 - Prob. 5AYLOCh. 25.5 - Prob. 6AYLOCh. 25.6 - What three classes of nutrients are most abundant?...Ch. 25.6 - Prob. 22BYGOCh. 25.6 - Prob. 23BYGOCh. 25.6 - Prob. 24BYGOCh. 25.6 - Prob. 25BYGOCh. 25.6 - Prob. 1AYLOCh. 25.6 - Prob. 2AYLOCh. 25.6 - Prob. 3AYLOCh. 25.6 - Prob. 4AYLOCh. 25.6 - Prob. 5AYLOCh. 25.6 - Prob. 6AYLOCh. 25.6 - Prob. 7AYLOCh. 25.6 - Differences between emulsification droplets,...Ch. 25.6 - Prob. 9AYLOCh. 25.6 - Prob. 10AYLOCh. 25.6 - Prob. 11AYLOCh. 25.7 - Prob. 26BYGOCh. 25.7 - Prob. 27BYGOCh. 25.7 - Prob. 28BYGOCh. 25.7 - Prob. 1AYLOCh. 25.7 - Prob. 2AYLOCh. 25.7 - Prob. 3AYLOCh. 25.7 - Mechanisms of the intrinsic and parasympathetic...Ch. 25 - Prob. 1TYRCh. 25 - Prob. 2TYRCh. 25 - Prob. 3TYRCh. 25 - Prob. 4TYRCh. 25 - Prob. 5TYRCh. 25 - All of the following contribute to the absorptive...Ch. 25 - Which of the following is a periodontal tissue? a....Ch. 25 - Prob. 8TYRCh. 25 - Prob. 9TYRCh. 25 - Prob. 10TYRCh. 25 - Cusps are a feature of the ______ surfaces of the...Ch. 25 - Prob. 12TYRCh. 25 - Prob. 13TYRCh. 25 - Prob. 14TYRCh. 25 - Nervous stimulation of gastrointestinal activity...Ch. 25 - Prob. 16TYRCh. 25 - Prob. 17TYRCh. 25 - Prob. 18TYRCh. 25 - Prob. 19TYRCh. 25 - Prob. 20TYRCh. 25 - Prob. 1BYMVCh. 25 - Prob. 2BYMVCh. 25 - -elleCh. 25 - Prob. 4BYMVCh. 25 - Prob. 5BYMVCh. 25 - Prob. 6BYMVCh. 25 - Prob. 7BYMVCh. 25 - porto-Ch. 25 - Prob. 9BYMVCh. 25 - Prob. 10BYMVCh. 25 - Prob. 1WWTSCh. 25 - Prob. 2WWTSCh. 25 - Prob. 3WWTSCh. 25 - Prob. 4WWTSCh. 25 - Lipids enter the circulation when the intestinal...Ch. 25 - Prob. 6WWTSCh. 25 - Prob. 7WWTSCh. 25 - Prob. 8WWTSCh. 25 - Prob. 9WWTSCh. 25 - Prob. 10WWTSCh. 25 - Prob. 1TYCCh. 25 - Prob. 2TYCCh. 25 - What do carboxypeptidase and aminopeptidase have...Ch. 25 - What do micelles and chylomicrons have in common?...Ch. 25 - Explain why most dietary lipids must be absorbed...
Knowledge Booster
Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning