ANAT.+PHYS.LAB MANUAL-W/ACCESS >CUSTOM<
9th Edition
ISBN: 9781265357948
Author: SALADIN
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 20.8, Problem 9AYLO
Summary Introduction
To discuss:
The femoral, deep femoral, and external iliac veins.
Introduction:
The veins are afferent vessels of the cardiovascular system; they carry deoxygenated blood from the organs to the heart. They are also called as capacitance vessels, as they have a flaccid and thin wall. When compared with arteries, they accommodate 64% more volume of blood. The veins have low blood pressure than arteries and have a steady blood flow.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 20 Solutions
ANAT.+PHYS.LAB MANUAL-W/ACCESS >CUSTOM<
Ch. 20.1 - Prob. 1BYGOCh. 20.1 - Prob. 2BYGOCh. 20.1 - Prob. 3BYGOCh. 20.1 - Prob. 4BYGOCh. 20.1 - Prob. 5BYGOCh. 20.1 - Prob. 6BYGOCh. 20.1 - Definitions of arteries, veins, and capillaries...Ch. 20.1 - Prob. 2AYLOCh. 20.1 - Prob. 3AYLOCh. 20.1 - Prob. 4AYLO
Ch. 20.1 - Prob. 5AYLOCh. 20.1 - Prob. 6AYLOCh. 20.1 - Prob. 7AYLOCh. 20.1 - Prob. 8AYLOCh. 20.1 - Prob. 9AYLOCh. 20.1 - Prob. 10AYLOCh. 20.1 - Prob. 11AYLOCh. 20.1 - Prob. 12AYLOCh. 20.1 - Prob. 13AYLOCh. 20.1 - Prob. 14AYLOCh. 20.1 - Prob. 15AYLOCh. 20.2 - Prob. 7BYGOCh. 20.2 - Prob. 8BYGOCh. 20.2 - Prob. 9BYGOCh. 20.2 - Prob. 10BYGOCh. 20.2 - Prob. 11BYGOCh. 20.2 - Prob. 12BYGOCh. 20.2 - Prob. 1AYLOCh. 20.2 - Prob. 2AYLOCh. 20.2 - Prob. 3AYLOCh. 20.2 - Prob. 4AYLOCh. 20.2 - Why arterial expansion and recoil during the...Ch. 20.2 - Prob. 6AYLOCh. 20.2 - Prob. 7AYLOCh. 20.2 - Prob. 8AYLOCh. 20.2 - Prob. 9AYLOCh. 20.2 - Prob. 10AYLOCh. 20.2 - Prob. 11AYLOCh. 20.2 - Why blood velocity declines from aorta to...Ch. 20.2 - Prob. 13AYLOCh. 20.2 - Prob. 14AYLOCh. 20.2 - Prob. 15AYLOCh. 20.2 - Prob. 16AYLOCh. 20.2 - Prob. 17AYLOCh. 20.2 - Prob. 18AYLOCh. 20.2 - Prob. 19AYLOCh. 20.3 - Prob. 13BYGOCh. 20.3 - Prob. 14BYGOCh. 20.3 - Prob. 15BYGOCh. 20.3 - State the three fundamental causes of edema and...Ch. 20.3 - Prob. 1AYLOCh. 20.3 - Prob. 2AYLOCh. 20.3 - Prob. 3AYLOCh. 20.3 - Prob. 4AYLOCh. 20.3 - Prob. 5AYLOCh. 20.3 - Prob. 6AYLOCh. 20.3 - Relative amounts of fluid given off and reabsorbed...Ch. 20.3 - The role of solvent drag in capillary exchangeCh. 20.3 - Why the dynamics of capillary absorption can...Ch. 20.3 - Prob. 10AYLOCh. 20.3 - Prob. 11AYLOCh. 20.4 - Prob. 17BYGOCh. 20.4 - Prob. 18BYGOCh. 20.4 - Prob. 19BYGOCh. 20.4 - Prob. 1AYLOCh. 20.4 - Prob. 2AYLOCh. 20.4 - Prob. 3AYLOCh. 20.4 - Prob. 4AYLOCh. 20.4 - Prob. 5AYLOCh. 20.4 - Prob. 6AYLOCh. 20.4 - Prob. 7AYLOCh. 20.4 - Prob. 8AYLOCh. 20.5 - Prob. 20BYGOCh. 20.5 - Prob. 21BYGOCh. 20.5 - Prob. 22BYGOCh. 20.5 - Prob. 23BYGOCh. 20.5 - Prob. 1AYLOCh. 20.5 - Prob. 2AYLOCh. 20.5 - Prob. 3AYLOCh. 20.5 - Variability of skeletal muscle perfusion; what...Ch. 20.5 - Prob. 5AYLOCh. 20.6 - Prob. 24BYGOCh. 20.6 - Prob. 25BYGOCh. 20.6 - Prob. 1AYLOCh. 20.6 - Prob. 2AYLOCh. 20.6 - Prob. 3AYLOCh. 20.7 - Prob. 26BYGOCh. 20.7 - Prob. 27BYGOCh. 20.7 - Prob. 28BYGOCh. 20.7 - Prob. 29BYGOCh. 20.7 - For all named blood vessels in this outline, their...Ch. 20.7 - The ascending aorta, aortic arch, and descending...Ch. 20.7 - Branches that arise from the ascending aorta and...Ch. 20.7 - Four principal arteries of the neck: the common...Ch. 20.7 - The external and internal carotid arteries;...Ch. 20.7 - Prob. 6AYLOCh. 20.7 - Prob. 7AYLOCh. 20.7 - Dural venous sinuses; the superior sagittal,...Ch. 20.7 - Prob. 9AYLOCh. 20.7 - Prob. 10AYLOCh. 20.7 - Prob. 11AYLOCh. 20.7 - Prob. 12AYLOCh. 20.7 - Prob. 13AYLOCh. 20.7 - Branches of the abdominal aorta: inferior phrenic...Ch. 20.7 - Prob. 15AYLOCh. 20.7 - Prob. 16AYLOCh. 20.7 - Prob. 17AYLOCh. 20.7 - Prob. 18AYLOCh. 20.7 - Prob. 19AYLOCh. 20.7 - Prob. 20AYLOCh. 20.7 - Prob. 21AYLOCh. 20.7 - Prob. 22AYLOCh. 20.8 - Prob. 30BYGOCh. 20.8 - Prob. 31BYGOCh. 20.8 - Prob. 32BYGOCh. 20.8 - Prob. 33BYGOCh. 20.8 - Prob. 1AYLOCh. 20.8 - Prob. 2AYLOCh. 20.8 - Prob. 3AYLOCh. 20.8 - Prob. 4AYLOCh. 20.8 - Prob. 5AYLOCh. 20.8 - Prob. 6AYLOCh. 20.8 - Prob. 7AYLOCh. 20.8 - Prob. 8AYLOCh. 20.8 - Prob. 9AYLOCh. 20 - Blood often flows into a capillary bed from a. the...Ch. 20 - Prob. 2TYRCh. 20 - A blood vessel adapted to withstand a high pulse...Ch. 20 - Prob. 4TYRCh. 20 - Prob. 5TYRCh. 20 - Prob. 6TYRCh. 20 - Blood flows fester in a venule than in a capillary...Ch. 20 - In a case where interstitial hydrostatic pressure...Ch. 20 - Intestinal blood flows to the liver by way of a....Ch. 20 - Prob. 10TYRCh. 20 - The highest arterial blood pressure attained...Ch. 20 - Prob. 12TYRCh. 20 - Prob. 13TYRCh. 20 - Prob. 14TYRCh. 20 - Prob. 15TYRCh. 20 - Prob. 16TYRCh. 20 - Prob. 17TYRCh. 20 - Prob. 18TYRCh. 20 - Prob. 19TYRCh. 20 - Prob. 20TYRCh. 20 - Prob. 1BYMVCh. 20 - Prob. 2BYMVCh. 20 - Prob. 3BYMVCh. 20 - Prob. 4BYMVCh. 20 - Prob. 5BYMVCh. 20 - -orumCh. 20 - Prob. 7BYMVCh. 20 - Prob. 8BYMVCh. 20 - Prob. 9BYMVCh. 20 - Prob. 10BYMVCh. 20 - Prob. 1WWTSCh. 20 - Blood always passes through exactly one capillary...Ch. 20 - Prob. 3WWTSCh. 20 - Prob. 4WWTSCh. 20 - Prob. 5WWTSCh. 20 - The femoral triangle is bordered by the inguinal...Ch. 20 - Prob. 7WWTSCh. 20 - Prob. 8WWTSCh. 20 - Prob. 9WWTSCh. 20 - Prob. 10WWTSCh. 20 - Prob. 1TYCCh. 20 - Prob. 2TYCCh. 20 - Prob. 3TYCCh. 20 - Prob. 4TYCCh. 20 - Discuss why it is advantageous to have...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
Excretory System; Author: Amoeba Sisters;https://www.youtube.com/watch?v=q5qaGHfdmYM;License: Standard youtube license