ANAT.+PHYS.LAB MANUAL-W/ACCESS >CUSTOM<
9th Edition
ISBN: 9781265357948
Author: SALADIN
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 20.3, Problem 15BYGO
Summary Introduction
Introduction:
The capillaries are known as the business ends or exchange vessels of the cardiovascular system. The passage of nutrients, hormones, leukocytes, and waste, to pass through the walls of the blood vessels into tissue, can occur through capillaries and venules. Capillaries only have a basal lamina and an endothelium.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 20 Solutions
ANAT.+PHYS.LAB MANUAL-W/ACCESS >CUSTOM<
Ch. 20.1 - Prob. 1BYGOCh. 20.1 - Prob. 2BYGOCh. 20.1 - Prob. 3BYGOCh. 20.1 - Prob. 4BYGOCh. 20.1 - Prob. 5BYGOCh. 20.1 - Prob. 6BYGOCh. 20.1 - Definitions of arteries, veins, and capillaries...Ch. 20.1 - Prob. 2AYLOCh. 20.1 - Prob. 3AYLOCh. 20.1 - Prob. 4AYLO
Ch. 20.1 - Prob. 5AYLOCh. 20.1 - Prob. 6AYLOCh. 20.1 - Prob. 7AYLOCh. 20.1 - Prob. 8AYLOCh. 20.1 - Prob. 9AYLOCh. 20.1 - Prob. 10AYLOCh. 20.1 - Prob. 11AYLOCh. 20.1 - Prob. 12AYLOCh. 20.1 - Prob. 13AYLOCh. 20.1 - Prob. 14AYLOCh. 20.1 - Prob. 15AYLOCh. 20.2 - Prob. 7BYGOCh. 20.2 - Prob. 8BYGOCh. 20.2 - Prob. 9BYGOCh. 20.2 - Prob. 10BYGOCh. 20.2 - Prob. 11BYGOCh. 20.2 - Prob. 12BYGOCh. 20.2 - Prob. 1AYLOCh. 20.2 - Prob. 2AYLOCh. 20.2 - Prob. 3AYLOCh. 20.2 - Prob. 4AYLOCh. 20.2 - Why arterial expansion and recoil during the...Ch. 20.2 - Prob. 6AYLOCh. 20.2 - Prob. 7AYLOCh. 20.2 - Prob. 8AYLOCh. 20.2 - Prob. 9AYLOCh. 20.2 - Prob. 10AYLOCh. 20.2 - Prob. 11AYLOCh. 20.2 - Why blood velocity declines from aorta to...Ch. 20.2 - Prob. 13AYLOCh. 20.2 - Prob. 14AYLOCh. 20.2 - Prob. 15AYLOCh. 20.2 - Prob. 16AYLOCh. 20.2 - Prob. 17AYLOCh. 20.2 - Prob. 18AYLOCh. 20.2 - Prob. 19AYLOCh. 20.3 - Prob. 13BYGOCh. 20.3 - Prob. 14BYGOCh. 20.3 - Prob. 15BYGOCh. 20.3 - State the three fundamental causes of edema and...Ch. 20.3 - Prob. 1AYLOCh. 20.3 - Prob. 2AYLOCh. 20.3 - Prob. 3AYLOCh. 20.3 - Prob. 4AYLOCh. 20.3 - Prob. 5AYLOCh. 20.3 - Prob. 6AYLOCh. 20.3 - Relative amounts of fluid given off and reabsorbed...Ch. 20.3 - The role of solvent drag in capillary exchangeCh. 20.3 - Why the dynamics of capillary absorption can...Ch. 20.3 - Prob. 10AYLOCh. 20.3 - Prob. 11AYLOCh. 20.4 - Prob. 17BYGOCh. 20.4 - Prob. 18BYGOCh. 20.4 - Prob. 19BYGOCh. 20.4 - Prob. 1AYLOCh. 20.4 - Prob. 2AYLOCh. 20.4 - Prob. 3AYLOCh. 20.4 - Prob. 4AYLOCh. 20.4 - Prob. 5AYLOCh. 20.4 - Prob. 6AYLOCh. 20.4 - Prob. 7AYLOCh. 20.4 - Prob. 8AYLOCh. 20.5 - Prob. 20BYGOCh. 20.5 - Prob. 21BYGOCh. 20.5 - Prob. 22BYGOCh. 20.5 - Prob. 23BYGOCh. 20.5 - Prob. 1AYLOCh. 20.5 - Prob. 2AYLOCh. 20.5 - Prob. 3AYLOCh. 20.5 - Variability of skeletal muscle perfusion; what...Ch. 20.5 - Prob. 5AYLOCh. 20.6 - Prob. 24BYGOCh. 20.6 - Prob. 25BYGOCh. 20.6 - Prob. 1AYLOCh. 20.6 - Prob. 2AYLOCh. 20.6 - Prob. 3AYLOCh. 20.7 - Prob. 26BYGOCh. 20.7 - Prob. 27BYGOCh. 20.7 - Prob. 28BYGOCh. 20.7 - Prob. 29BYGOCh. 20.7 - For all named blood vessels in this outline, their...Ch. 20.7 - The ascending aorta, aortic arch, and descending...Ch. 20.7 - Branches that arise from the ascending aorta and...Ch. 20.7 - Four principal arteries of the neck: the common...Ch. 20.7 - The external and internal carotid arteries;...Ch. 20.7 - Prob. 6AYLOCh. 20.7 - Prob. 7AYLOCh. 20.7 - Dural venous sinuses; the superior sagittal,...Ch. 20.7 - Prob. 9AYLOCh. 20.7 - Prob. 10AYLOCh. 20.7 - Prob. 11AYLOCh. 20.7 - Prob. 12AYLOCh. 20.7 - Prob. 13AYLOCh. 20.7 - Branches of the abdominal aorta: inferior phrenic...Ch. 20.7 - Prob. 15AYLOCh. 20.7 - Prob. 16AYLOCh. 20.7 - Prob. 17AYLOCh. 20.7 - Prob. 18AYLOCh. 20.7 - Prob. 19AYLOCh. 20.7 - Prob. 20AYLOCh. 20.7 - Prob. 21AYLOCh. 20.7 - Prob. 22AYLOCh. 20.8 - Prob. 30BYGOCh. 20.8 - Prob. 31BYGOCh. 20.8 - Prob. 32BYGOCh. 20.8 - Prob. 33BYGOCh. 20.8 - Prob. 1AYLOCh. 20.8 - Prob. 2AYLOCh. 20.8 - Prob. 3AYLOCh. 20.8 - Prob. 4AYLOCh. 20.8 - Prob. 5AYLOCh. 20.8 - Prob. 6AYLOCh. 20.8 - Prob. 7AYLOCh. 20.8 - Prob. 8AYLOCh. 20.8 - Prob. 9AYLOCh. 20 - Blood often flows into a capillary bed from a. the...Ch. 20 - Prob. 2TYRCh. 20 - A blood vessel adapted to withstand a high pulse...Ch. 20 - Prob. 4TYRCh. 20 - Prob. 5TYRCh. 20 - Prob. 6TYRCh. 20 - Blood flows fester in a venule than in a capillary...Ch. 20 - In a case where interstitial hydrostatic pressure...Ch. 20 - Intestinal blood flows to the liver by way of a....Ch. 20 - Prob. 10TYRCh. 20 - The highest arterial blood pressure attained...Ch. 20 - Prob. 12TYRCh. 20 - Prob. 13TYRCh. 20 - Prob. 14TYRCh. 20 - Prob. 15TYRCh. 20 - Prob. 16TYRCh. 20 - Prob. 17TYRCh. 20 - Prob. 18TYRCh. 20 - Prob. 19TYRCh. 20 - Prob. 20TYRCh. 20 - Prob. 1BYMVCh. 20 - Prob. 2BYMVCh. 20 - Prob. 3BYMVCh. 20 - Prob. 4BYMVCh. 20 - Prob. 5BYMVCh. 20 - -orumCh. 20 - Prob. 7BYMVCh. 20 - Prob. 8BYMVCh. 20 - Prob. 9BYMVCh. 20 - Prob. 10BYMVCh. 20 - Prob. 1WWTSCh. 20 - Blood always passes through exactly one capillary...Ch. 20 - Prob. 3WWTSCh. 20 - Prob. 4WWTSCh. 20 - Prob. 5WWTSCh. 20 - The femoral triangle is bordered by the inguinal...Ch. 20 - Prob. 7WWTSCh. 20 - Prob. 8WWTSCh. 20 - Prob. 9WWTSCh. 20 - Prob. 10WWTSCh. 20 - Prob. 1TYCCh. 20 - Prob. 2TYCCh. 20 - Prob. 3TYCCh. 20 - Prob. 4TYCCh. 20 - Discuss why it is advantageous to have...
Knowledge Booster
Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning