ANAT.+PHYS.LAB MANUAL-W/ACCESS >CUSTOM<
9th Edition
ISBN: 9781265357948
Author: SALADIN
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 20.7, Problem 27BYGO
Summary Introduction
Introduction:
Arteries are the resistance vessels that give oxygenated blood to the organs. Arteries are known for their strong and resilient tissues that can withstand the pressure created by the heart. They are more muscular in nature than veins and are able to maintain their round shape even when the vessels are empty.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 20 Solutions
ANAT.+PHYS.LAB MANUAL-W/ACCESS >CUSTOM<
Ch. 20.1 - Prob. 1BYGOCh. 20.1 - Prob. 2BYGOCh. 20.1 - Prob. 3BYGOCh. 20.1 - Prob. 4BYGOCh. 20.1 - Prob. 5BYGOCh. 20.1 - Prob. 6BYGOCh. 20.1 - Definitions of arteries, veins, and capillaries...Ch. 20.1 - Prob. 2AYLOCh. 20.1 - Prob. 3AYLOCh. 20.1 - Prob. 4AYLO
Ch. 20.1 - Prob. 5AYLOCh. 20.1 - Prob. 6AYLOCh. 20.1 - Prob. 7AYLOCh. 20.1 - Prob. 8AYLOCh. 20.1 - Prob. 9AYLOCh. 20.1 - Prob. 10AYLOCh. 20.1 - Prob. 11AYLOCh. 20.1 - Prob. 12AYLOCh. 20.1 - Prob. 13AYLOCh. 20.1 - Prob. 14AYLOCh. 20.1 - Prob. 15AYLOCh. 20.2 - Prob. 7BYGOCh. 20.2 - Prob. 8BYGOCh. 20.2 - Prob. 9BYGOCh. 20.2 - Prob. 10BYGOCh. 20.2 - Prob. 11BYGOCh. 20.2 - Prob. 12BYGOCh. 20.2 - Prob. 1AYLOCh. 20.2 - Prob. 2AYLOCh. 20.2 - Prob. 3AYLOCh. 20.2 - Prob. 4AYLOCh. 20.2 - Why arterial expansion and recoil during the...Ch. 20.2 - Prob. 6AYLOCh. 20.2 - Prob. 7AYLOCh. 20.2 - Prob. 8AYLOCh. 20.2 - Prob. 9AYLOCh. 20.2 - Prob. 10AYLOCh. 20.2 - Prob. 11AYLOCh. 20.2 - Why blood velocity declines from aorta to...Ch. 20.2 - Prob. 13AYLOCh. 20.2 - Prob. 14AYLOCh. 20.2 - Prob. 15AYLOCh. 20.2 - Prob. 16AYLOCh. 20.2 - Prob. 17AYLOCh. 20.2 - Prob. 18AYLOCh. 20.2 - Prob. 19AYLOCh. 20.3 - Prob. 13BYGOCh. 20.3 - Prob. 14BYGOCh. 20.3 - Prob. 15BYGOCh. 20.3 - State the three fundamental causes of edema and...Ch. 20.3 - Prob. 1AYLOCh. 20.3 - Prob. 2AYLOCh. 20.3 - Prob. 3AYLOCh. 20.3 - Prob. 4AYLOCh. 20.3 - Prob. 5AYLOCh. 20.3 - Prob. 6AYLOCh. 20.3 - Relative amounts of fluid given off and reabsorbed...Ch. 20.3 - The role of solvent drag in capillary exchangeCh. 20.3 - Why the dynamics of capillary absorption can...Ch. 20.3 - Prob. 10AYLOCh. 20.3 - Prob. 11AYLOCh. 20.4 - Prob. 17BYGOCh. 20.4 - Prob. 18BYGOCh. 20.4 - Prob. 19BYGOCh. 20.4 - Prob. 1AYLOCh. 20.4 - Prob. 2AYLOCh. 20.4 - Prob. 3AYLOCh. 20.4 - Prob. 4AYLOCh. 20.4 - Prob. 5AYLOCh. 20.4 - Prob. 6AYLOCh. 20.4 - Prob. 7AYLOCh. 20.4 - Prob. 8AYLOCh. 20.5 - Prob. 20BYGOCh. 20.5 - Prob. 21BYGOCh. 20.5 - Prob. 22BYGOCh. 20.5 - Prob. 23BYGOCh. 20.5 - Prob. 1AYLOCh. 20.5 - Prob. 2AYLOCh. 20.5 - Prob. 3AYLOCh. 20.5 - Variability of skeletal muscle perfusion; what...Ch. 20.5 - Prob. 5AYLOCh. 20.6 - Prob. 24BYGOCh. 20.6 - Prob. 25BYGOCh. 20.6 - Prob. 1AYLOCh. 20.6 - Prob. 2AYLOCh. 20.6 - Prob. 3AYLOCh. 20.7 - Prob. 26BYGOCh. 20.7 - Prob. 27BYGOCh. 20.7 - Prob. 28BYGOCh. 20.7 - Prob. 29BYGOCh. 20.7 - For all named blood vessels in this outline, their...Ch. 20.7 - The ascending aorta, aortic arch, and descending...Ch. 20.7 - Branches that arise from the ascending aorta and...Ch. 20.7 - Four principal arteries of the neck: the common...Ch. 20.7 - The external and internal carotid arteries;...Ch. 20.7 - Prob. 6AYLOCh. 20.7 - Prob. 7AYLOCh. 20.7 - Dural venous sinuses; the superior sagittal,...Ch. 20.7 - Prob. 9AYLOCh. 20.7 - Prob. 10AYLOCh. 20.7 - Prob. 11AYLOCh. 20.7 - Prob. 12AYLOCh. 20.7 - Prob. 13AYLOCh. 20.7 - Branches of the abdominal aorta: inferior phrenic...Ch. 20.7 - Prob. 15AYLOCh. 20.7 - Prob. 16AYLOCh. 20.7 - Prob. 17AYLOCh. 20.7 - Prob. 18AYLOCh. 20.7 - Prob. 19AYLOCh. 20.7 - Prob. 20AYLOCh. 20.7 - Prob. 21AYLOCh. 20.7 - Prob. 22AYLOCh. 20.8 - Prob. 30BYGOCh. 20.8 - Prob. 31BYGOCh. 20.8 - Prob. 32BYGOCh. 20.8 - Prob. 33BYGOCh. 20.8 - Prob. 1AYLOCh. 20.8 - Prob. 2AYLOCh. 20.8 - Prob. 3AYLOCh. 20.8 - Prob. 4AYLOCh. 20.8 - Prob. 5AYLOCh. 20.8 - Prob. 6AYLOCh. 20.8 - Prob. 7AYLOCh. 20.8 - Prob. 8AYLOCh. 20.8 - Prob. 9AYLOCh. 20 - Blood often flows into a capillary bed from a. the...Ch. 20 - Prob. 2TYRCh. 20 - A blood vessel adapted to withstand a high pulse...Ch. 20 - Prob. 4TYRCh. 20 - Prob. 5TYRCh. 20 - Prob. 6TYRCh. 20 - Blood flows fester in a venule than in a capillary...Ch. 20 - In a case where interstitial hydrostatic pressure...Ch. 20 - Intestinal blood flows to the liver by way of a....Ch. 20 - Prob. 10TYRCh. 20 - The highest arterial blood pressure attained...Ch. 20 - Prob. 12TYRCh. 20 - Prob. 13TYRCh. 20 - Prob. 14TYRCh. 20 - Prob. 15TYRCh. 20 - Prob. 16TYRCh. 20 - Prob. 17TYRCh. 20 - Prob. 18TYRCh. 20 - Prob. 19TYRCh. 20 - Prob. 20TYRCh. 20 - Prob. 1BYMVCh. 20 - Prob. 2BYMVCh. 20 - Prob. 3BYMVCh. 20 - Prob. 4BYMVCh. 20 - Prob. 5BYMVCh. 20 - -orumCh. 20 - Prob. 7BYMVCh. 20 - Prob. 8BYMVCh. 20 - Prob. 9BYMVCh. 20 - Prob. 10BYMVCh. 20 - Prob. 1WWTSCh. 20 - Blood always passes through exactly one capillary...Ch. 20 - Prob. 3WWTSCh. 20 - Prob. 4WWTSCh. 20 - Prob. 5WWTSCh. 20 - The femoral triangle is bordered by the inguinal...Ch. 20 - Prob. 7WWTSCh. 20 - Prob. 8WWTSCh. 20 - Prob. 9WWTSCh. 20 - Prob. 10WWTSCh. 20 - Prob. 1TYCCh. 20 - Prob. 2TYCCh. 20 - Prob. 3TYCCh. 20 - Prob. 4TYCCh. 20 - Discuss why it is advantageous to have...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningFundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningCardiopulmonary Anatomy & PhysiologyBiologyISBN:9781337794909Author:Des Jardins, Terry.Publisher:Cengage Learning,
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Cardiopulmonary Anatomy & Physiology
Biology
ISBN:9781337794909
Author:Des Jardins, Terry.
Publisher:Cengage Learning,
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Anatomical Position And Directional Terms - Anatomical Terms - Directional Terms Anatomy; Author: Whats Up Dude;https://www.youtube.com/watch?v=pQUMJ6Gh9Bw;License: Standard YouTube License, CC-BY