ANAT.+PHYS.LAB MANUAL-W/ACCESS >CUSTOM<
9th Edition
ISBN: 9781265357948
Author: SALADIN
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 20, Problem 8WWTS
Summary Introduction
Introduction:
The capillaries are known as the business ends or exchange vessels of the cardiovascular system. For the passage of nutrients, hormones, leukocytes, and waste pass through the walls of the blood vessels into tissue; it can occur through capillaries and venules. Capillaries only have a basal lamina and an endothelium. Based on their function, the capillaries are classified into three types, namely continuous capillaries, fenestrated capillaries, and sinusoid capillaries.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 20 Solutions
ANAT.+PHYS.LAB MANUAL-W/ACCESS >CUSTOM<
Ch. 20.1 - Prob. 1BYGOCh. 20.1 - Prob. 2BYGOCh. 20.1 - Prob. 3BYGOCh. 20.1 - Prob. 4BYGOCh. 20.1 - Prob. 5BYGOCh. 20.1 - Prob. 6BYGOCh. 20.1 - Definitions of arteries, veins, and capillaries...Ch. 20.1 - Prob. 2AYLOCh. 20.1 - Prob. 3AYLOCh. 20.1 - Prob. 4AYLO
Ch. 20.1 - Prob. 5AYLOCh. 20.1 - Prob. 6AYLOCh. 20.1 - Prob. 7AYLOCh. 20.1 - Prob. 8AYLOCh. 20.1 - Prob. 9AYLOCh. 20.1 - Prob. 10AYLOCh. 20.1 - Prob. 11AYLOCh. 20.1 - Prob. 12AYLOCh. 20.1 - Prob. 13AYLOCh. 20.1 - Prob. 14AYLOCh. 20.1 - Prob. 15AYLOCh. 20.2 - Prob. 7BYGOCh. 20.2 - Prob. 8BYGOCh. 20.2 - Prob. 9BYGOCh. 20.2 - Prob. 10BYGOCh. 20.2 - Prob. 11BYGOCh. 20.2 - Prob. 12BYGOCh. 20.2 - Prob. 1AYLOCh. 20.2 - Prob. 2AYLOCh. 20.2 - Prob. 3AYLOCh. 20.2 - Prob. 4AYLOCh. 20.2 - Why arterial expansion and recoil during the...Ch. 20.2 - Prob. 6AYLOCh. 20.2 - Prob. 7AYLOCh. 20.2 - Prob. 8AYLOCh. 20.2 - Prob. 9AYLOCh. 20.2 - Prob. 10AYLOCh. 20.2 - Prob. 11AYLOCh. 20.2 - Why blood velocity declines from aorta to...Ch. 20.2 - Prob. 13AYLOCh. 20.2 - Prob. 14AYLOCh. 20.2 - Prob. 15AYLOCh. 20.2 - Prob. 16AYLOCh. 20.2 - Prob. 17AYLOCh. 20.2 - Prob. 18AYLOCh. 20.2 - Prob. 19AYLOCh. 20.3 - Prob. 13BYGOCh. 20.3 - Prob. 14BYGOCh. 20.3 - Prob. 15BYGOCh. 20.3 - State the three fundamental causes of edema and...Ch. 20.3 - Prob. 1AYLOCh. 20.3 - Prob. 2AYLOCh. 20.3 - Prob. 3AYLOCh. 20.3 - Prob. 4AYLOCh. 20.3 - Prob. 5AYLOCh. 20.3 - Prob. 6AYLOCh. 20.3 - Relative amounts of fluid given off and reabsorbed...Ch. 20.3 - The role of solvent drag in capillary exchangeCh. 20.3 - Why the dynamics of capillary absorption can...Ch. 20.3 - Prob. 10AYLOCh. 20.3 - Prob. 11AYLOCh. 20.4 - Prob. 17BYGOCh. 20.4 - Prob. 18BYGOCh. 20.4 - Prob. 19BYGOCh. 20.4 - Prob. 1AYLOCh. 20.4 - Prob. 2AYLOCh. 20.4 - Prob. 3AYLOCh. 20.4 - Prob. 4AYLOCh. 20.4 - Prob. 5AYLOCh. 20.4 - Prob. 6AYLOCh. 20.4 - Prob. 7AYLOCh. 20.4 - Prob. 8AYLOCh. 20.5 - Prob. 20BYGOCh. 20.5 - Prob. 21BYGOCh. 20.5 - Prob. 22BYGOCh. 20.5 - Prob. 23BYGOCh. 20.5 - Prob. 1AYLOCh. 20.5 - Prob. 2AYLOCh. 20.5 - Prob. 3AYLOCh. 20.5 - Variability of skeletal muscle perfusion; what...Ch. 20.5 - Prob. 5AYLOCh. 20.6 - Prob. 24BYGOCh. 20.6 - Prob. 25BYGOCh. 20.6 - Prob. 1AYLOCh. 20.6 - Prob. 2AYLOCh. 20.6 - Prob. 3AYLOCh. 20.7 - Prob. 26BYGOCh. 20.7 - Prob. 27BYGOCh. 20.7 - Prob. 28BYGOCh. 20.7 - Prob. 29BYGOCh. 20.7 - For all named blood vessels in this outline, their...Ch. 20.7 - The ascending aorta, aortic arch, and descending...Ch. 20.7 - Branches that arise from the ascending aorta and...Ch. 20.7 - Four principal arteries of the neck: the common...Ch. 20.7 - The external and internal carotid arteries;...Ch. 20.7 - Prob. 6AYLOCh. 20.7 - Prob. 7AYLOCh. 20.7 - Dural venous sinuses; the superior sagittal,...Ch. 20.7 - Prob. 9AYLOCh. 20.7 - Prob. 10AYLOCh. 20.7 - Prob. 11AYLOCh. 20.7 - Prob. 12AYLOCh. 20.7 - Prob. 13AYLOCh. 20.7 - Branches of the abdominal aorta: inferior phrenic...Ch. 20.7 - Prob. 15AYLOCh. 20.7 - Prob. 16AYLOCh. 20.7 - Prob. 17AYLOCh. 20.7 - Prob. 18AYLOCh. 20.7 - Prob. 19AYLOCh. 20.7 - Prob. 20AYLOCh. 20.7 - Prob. 21AYLOCh. 20.7 - Prob. 22AYLOCh. 20.8 - Prob. 30BYGOCh. 20.8 - Prob. 31BYGOCh. 20.8 - Prob. 32BYGOCh. 20.8 - Prob. 33BYGOCh. 20.8 - Prob. 1AYLOCh. 20.8 - Prob. 2AYLOCh. 20.8 - Prob. 3AYLOCh. 20.8 - Prob. 4AYLOCh. 20.8 - Prob. 5AYLOCh. 20.8 - Prob. 6AYLOCh. 20.8 - Prob. 7AYLOCh. 20.8 - Prob. 8AYLOCh. 20.8 - Prob. 9AYLOCh. 20 - Blood often flows into a capillary bed from a. the...Ch. 20 - Prob. 2TYRCh. 20 - A blood vessel adapted to withstand a high pulse...Ch. 20 - Prob. 4TYRCh. 20 - Prob. 5TYRCh. 20 - Prob. 6TYRCh. 20 - Blood flows fester in a venule than in a capillary...Ch. 20 - In a case where interstitial hydrostatic pressure...Ch. 20 - Intestinal blood flows to the liver by way of a....Ch. 20 - Prob. 10TYRCh. 20 - The highest arterial blood pressure attained...Ch. 20 - Prob. 12TYRCh. 20 - Prob. 13TYRCh. 20 - Prob. 14TYRCh. 20 - Prob. 15TYRCh. 20 - Prob. 16TYRCh. 20 - Prob. 17TYRCh. 20 - Prob. 18TYRCh. 20 - Prob. 19TYRCh. 20 - Prob. 20TYRCh. 20 - Prob. 1BYMVCh. 20 - Prob. 2BYMVCh. 20 - Prob. 3BYMVCh. 20 - Prob. 4BYMVCh. 20 - Prob. 5BYMVCh. 20 - -orumCh. 20 - Prob. 7BYMVCh. 20 - Prob. 8BYMVCh. 20 - Prob. 9BYMVCh. 20 - Prob. 10BYMVCh. 20 - Prob. 1WWTSCh. 20 - Blood always passes through exactly one capillary...Ch. 20 - Prob. 3WWTSCh. 20 - Prob. 4WWTSCh. 20 - Prob. 5WWTSCh. 20 - The femoral triangle is bordered by the inguinal...Ch. 20 - Prob. 7WWTSCh. 20 - Prob. 8WWTSCh. 20 - Prob. 9WWTSCh. 20 - Prob. 10WWTSCh. 20 - Prob. 1TYCCh. 20 - Prob. 2TYCCh. 20 - Prob. 3TYCCh. 20 - Prob. 4TYCCh. 20 - Discuss why it is advantageous to have...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Complications during Labour and Delivery; Author: FirstCry Parenting;https://www.youtube.com/watch?v=QnCviG4GpYg;License: Standard YouTube License, CC-BY