
Concept explainers
To explain:
What type of microbial blooms might be triggered if the sewage plant releasing sewage containing high levels of ammonia, phosphate and very low levels of organic carbon. How would the graphs of oxygen beyond and near the plant’s release point vary from the graph?
Concept introduction:
A type of waste water that generated by the community of individual is called as the sewage. It is also called as domestic waste water or municipal waste water. It is indicated by the rate of flow or volume, chemical, toxic constituents and physical condition. Mostly the sewage consists of human waste, detergents and soaps.

Explanation of Solution
The release of very low levels of organic carbon, high levels of phosphate and ammonia from a sewage treatment plant would activate the growth of cyanobacteria, algae and nitrifying the bacteria that will oxidize ammonium (NH4+) to NO3+. The graph of oxygen shows difference that decrease nearby the outflow due to the presence of small organic carbon and the organism which respires aerobically would not consume it at a comparable amount.
Further, the cyanobacteria and blooms are contributing to increase the dissolved oxygen levels nearby the release point of the sewage due to oxygenic photosynthesis. However, the initial blooms of cyanobacteria and algae has finally results in decreased dissolved oxygen. Because the phototrophs mass start to decompose and die by the aerobic bacteria which will consume the oxygen present in the water.
Want to see more full solutions like this?
Chapter 20 Solutions
Brock Biology of Microorganisms (15th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax


