
Genetics: A Conceptual Approach 6E w/ SaplingPlus (Six-Month Access)
6th Edition
ISBN: 9781319125929
Author: Benjamin A. Pierce
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Question
Chapter 19.5, Problem 40AQP
Summary Introduction
To determine:
The sequence of the normal and mutated copy of the gene.
Introduction:
Cystic fibrosis is a genetic disorder. It mostly affects the lungs, liver, kidney, and pancreas. Gel electrophoresis is the technique used to separate macromolecule on the basis of their size and charge. The smaller molecule in size will easily pass across the pores but the larger molecule will take time.
Summary Introduction
To determine:
The location of the mutation that causes cystic fibrosis.
Introduction:
Cystic fibrosis is a genetic disorder. It affects the lungs and
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 19 Solutions
Genetics: A Conceptual Approach 6E w/ SaplingPlus (Six-Month Access)
Ch. 19.1 - Prob. 1COQCh. 19.1 - Prob. 1TPSQCh. 19.2 - Prob. 1CCCh. 19.2 - Prob. 2CCCh. 19.2 - Prob. 3CCCh. 19.2 - Prob. 2COQCh. 19.2 - Prob. 3COQCh. 19.2 - Prob. 4COQCh. 19.2 - Prob. 5COQCh. 19.2 - Prob. 6COQ
Ch. 19.2 - Prob. 24AQPCh. 19.2 - Prob. 25AQPCh. 19.2 - Prob. 26AQPCh. 19.2 - Prob. 27AQPCh. 19.2 - Prob. 28AQPCh. 19.2 - Prob. 29AQPCh. 19.2 - Prob. 30AQPCh. 19.2 - Prob. 2TPSQCh. 19.2 - Prob. 3TPSQCh. 19.2 - Prob. 4TPSQCh. 19.3 - Prob. 4CCCh. 19.3 - Prob. 5CCCh. 19.3 - Prob. 7COQCh. 19.3 - Prob. 8COQCh. 19.3 - Prob. 9COQCh. 19.3 - Prob. 10COQCh. 19.3 - Prob. 11COQCh. 19.3 - Prob. 31AQPCh. 19.3 - Prob. 32AQPCh. 19.3 - Prob. 33AQPCh. 19.3 - Prob. 34AQPCh. 19.3 - Prob. 5TPSQCh. 19.4 - Prob. 6CCCh. 19.4 - Prob. 7CCCh. 19.4 - Prob. 12COQCh. 19.4 - Prob. 13COQCh. 19.4 - Prob. 14COQCh. 19.4 - Prob. 15COQCh. 19.4 - Prob. 16COQCh. 19.4 - Prob. 35AQPCh. 19.4 - Prob. 36AQPCh. 19.4 - Prob. 37AQPCh. 19.4 - Prob. 6TPSQCh. 19.5 - Prob. 8CCCh. 19.5 - Prob. 9CCCh. 19.5 - Prob. 17COQCh. 19.5 - Prob. 18COQCh. 19.5 - Prob. 38AQPCh. 19.5 - Prob. 39AQPCh. 19.5 - Prob. 40AQPCh. 19.6 - Prob. 10CCCh. 19.6 - Prob. 11CCCh. 19.6 - Prob. 19COQCh. 19.6 - Prob. 20COQCh. 19.6 - Prob. 21COQCh. 19.6 - Prob. 22COQCh. 19.6 - Prob. 41AQPCh. 19.6 - Prob. 42AQPCh. 19.6 - Prob. 43CQCh. 19.7 - Prob. 12CCCh. 19.7 - Prob. 13CCCh. 19.7 - Prob. 23COQCh. 19.7 - Prob. 7TPSQCh. 19.7 - Prob. 8TPSQ
Knowledge Booster
Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education