
Concept explainers
A.
To explain: All cells including all their phases in their cell cycle are expected to contain radioactive DNA after labeling procedure.
Concept introduction: Cells are cultured in culture mediums that contain all the necessary nutrients for the cell to grow and divide. Cells that are tested for cell cycle are usually loaded with
B.
To explain: The reason why initially there were no mitotic cells that possessed radioactive DNA.
Concept introduction: Cells are cultured in culture mediums that contain all the necessary nutrients for the cell to grow and divide. Cells that are tested for cell cycle are usually loaded with nucleotides to assess the S phase of the experiment. The DNA is usually found as chromatin reticulum, fine thread-like structures in the nucleus during interphase. When the cell is about to divide, the chromosome undergoes condensation to compact its structure. This structure when stained with suitable dyes is visible during the M phase of the cell cycle. Autoradiography is a technique where the nucleotides are radiolabelled with radioactive isotope of an atom present in them, mostly nitrogen or carbon isotope. These radiolabelled nucleotides when they are incorporated into the DNA during cell division emit radiation. The radioactivity is captured using photographic emulsion. This photographic emulsion when placed over the cells, the radioactive isotope activates the emulsion and wherever the radioactivity is exhibited black dots are observed in the emulsion.
C.
To explain: The rise and fall and again the rise of the curve.
Concept introduction: Cells are cultured in culture mediums that contain all the necessary nutrients for the cell to grow and divide. Cells that are tested for cell cycle are usually loaded with nucleotides to assess the S phase of the experiment. The DNA is usually found as chromatin reticulum, fine thread-like structures in the nucleus during interphase. When the cell is about to divide, the chromosome undergoes condensation to compact its structure. This structure when stained with suitable dyes is visible during the M phase of the cell cycle. Autoradiography is a technique where the nucleotides are radiolabelled with radioactive isotope of an atom present in them, mostly nitrogen or carbon isotope. These radiolabelled nucleotides when they are incorporated into the DNA during cell division emit radiation. The radioactivity is captured using photographic emulsion. This photographic emulsion when placed over the cells, the radioactive isotope activates the emulsion and wherever the radioactivity is exhibited black dots are observed in the emulsion.
D.
To estimate: The length of G2 phase from the graph obtained.
Concept introduction: Cells are cultured in culture mediums that contain all the necessary nutrients for the cell to grow and divide. Cells that are tested for cell cycle are usually loaded with nucleotides to assess the S phase of the experiment. The DNA is usually found as chromatin reticulum, fine thread-like structures in the nucleus during interphase. When the cell is about to divide, the chromosome undergoes condensation to compact its structure. This structure when stained with suitable dyes is visible during the M phase of the cell cycle. Autoradiography is a technique where the nucleotides are radiolabelled with radioactive isotope of an atom present in them, mostly nitrogen or carbon isotope. These radiolabelled nucleotides when they are incorporated into the DNA during cell division emit radiation. The radioactivity is captured using photographic emulsion. This photographic emulsion when placed over the cells, the radioactive isotope activates the emulsion and wherever the radioactivity is exhibited black dots are observed in the emulsion.

Want to see the full answer?
Check out a sample textbook solution
Chapter 18 Solutions
Essential Cell Biology (fifth Edition)
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





