Essential Cell Biology (fifth Edition)
Essential Cell Biology (fifth Edition)
5th Edition
ISBN: 9780393680362
Author: ALBERTS, Bruce, Hopkin, Karen, Johnson -
Publisher: W. W. Norton & Company
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 18, Problem 14Q

A.

Summary Introduction

To explain: All cells including all their phases in their cell cycle are expected to contain radioactive DNA after labeling procedure.

Concept introduction: Cells are cultured in culture mediums that contain all the necessary nutrients for the cell to grow and divide. Cells that are tested for cell cycle are usually loaded with nucleotides to assess the S phase of the experiment. The DNA is usually found as chromatin reticulum, fine thread-like structures in the nucleus during interphase. When the cell is about to divide, the chromosome undergoes condensation to compact its structure. This structure when stained with suitable dyes is visible during the M phase of the cell cycle. Autoradiography is a technique where the nucleotides are radiolabelled with radioactive isotope of an atom present in them, mostly nitrogen or carbon isotope. These radiolabelled nucleotides when they are incorporated into the DNA during cell division emit radiation.  The radioactivity is captured using photographic emulsion. This photographic emulsion when placed over the cells, the radioactive isotope activates the emulsion and wherever the radioactivity is exhibited black dots are observed in the emulsion.

B.

Summary Introduction

To explain: The reason why initially there were no mitotic cells that possessed radioactive DNA.

Concept introduction: Cells are cultured in culture mediums that contain all the necessary nutrients for the cell to grow and divide. Cells that are tested for cell cycle are usually loaded with nucleotides to assess the S phase of the experiment. The DNA is usually found as chromatin reticulum, fine thread-like structures in the nucleus during interphase. When the cell is about to divide, the chromosome undergoes condensation to compact its structure. This structure when stained with suitable dyes is visible during the M phase of the cell cycle. Autoradiography is a technique where the nucleotides are radiolabelled with radioactive isotope of an atom present in them, mostly nitrogen or carbon isotope. These radiolabelled nucleotides when they are incorporated into the DNA during cell division emit radiation.  The radioactivity is captured using photographic emulsion. This photographic emulsion when placed over the cells, the radioactive isotope activates the emulsion and wherever the radioactivity is exhibited black dots are observed in the emulsion.

C.

Summary Introduction

To explain: The rise and fall and again the rise of the curve.

Concept introduction: Cells are cultured in culture mediums that contain all the necessary nutrients for the cell to grow and divide. Cells that are tested for cell cycle are usually loaded with nucleotides to assess the S phase of the experiment. The DNA is usually found as chromatin reticulum, fine thread-like structures in the nucleus during interphase. When the cell is about to divide, the chromosome undergoes condensation to compact its structure. This structure when stained with suitable dyes is visible during the M phase of the cell cycle. Autoradiography is a technique where the nucleotides are radiolabelled with radioactive isotope of an atom present in them, mostly nitrogen or carbon isotope. These radiolabelled nucleotides when they are incorporated into the DNA during cell division emit radiation.  The radioactivity is captured using photographic emulsion. This photographic emulsion when placed over the cells, the radioactive isotope activates the emulsion and wherever the radioactivity is exhibited black dots are observed in the emulsion.

D.

Summary Introduction

To estimate: The length of G2 phase from the graph obtained.

Concept introduction: Cells are cultured in culture mediums that contain all the necessary nutrients for the cell to grow and divide. Cells that are tested for cell cycle are usually loaded with nucleotides to assess the S phase of the experiment. The DNA is usually found as chromatin reticulum, fine thread-like structures in the nucleus during interphase. When the cell is about to divide, the chromosome undergoes condensation to compact its structure. This structure when stained with suitable dyes is visible during the M phase of the cell cycle. Autoradiography is a technique where the nucleotides are radiolabelled with radioactive isotope of an atom present in them, mostly nitrogen or carbon isotope. These radiolabelled nucleotides when they are incorporated into the DNA during cell division emit radiation.  The radioactivity is captured using photographic emulsion. This photographic emulsion when placed over the cells, the radioactive isotope activates the emulsion and wherever the radioactivity is exhibited black dots are observed in the emulsion.

Blurred answer
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License