ANAT.+PHYSIO.1-LAB.MAN. >CUSTOM<
20th Edition
ISBN: 9781264303106
Author: VanPutte
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 17.4, Problem 21AYP
Summary Introduction
To analyze:
The mechanism of hormone entering the plasma membrane and affecting the protein synthesis.
Introduction:
The direct intercellular signaling involves the signal molecules to move from one cell to the adjacent cell and not over long distances. Contact dependent signaling involves the dependency of the contact by signal to target molecule and so cannot travel a long distance.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 17 Solutions
ANAT.+PHYSIO.1-LAB.MAN. >CUSTOM<
Ch. 17.1 - How does an endocrine gland differ from an...Ch. 17.1 - Prob. 2AYPCh. 17.1 - In what ways does the nervous system differ from...Ch. 17.1 - Name and describe the four classes of chemical...Ch. 17.2 - Prob. 5AYPCh. 17.2 - Prob. 6AYPCh. 17.2 - Prob. 7AYPCh. 17.2 - What effect does a bound hormone have on the...Ch. 17.2 - What are the two chemical categories of hormones?...Ch. 17.2 - Describe how the chemical nature of a hormone...
Ch. 17.2 - Prob. 11AYPCh. 17.2 - Why do organs regulated by protein hormones have...Ch. 17.2 - Prob. 13AYPCh. 17.2 - Describe chronic, acute, and episodic patterns of...Ch. 17.3 - Describe and give examples of the three major ways...Ch. 17.3 - Prob. 16AYPCh. 17.4 - What characteristics ofa hormone receptor make...Ch. 17.4 - What is down-regulation, and what may cause it to...Ch. 17.4 - Prob. 19AYPCh. 17.4 - What are the two classes of hormone receptors? How...Ch. 17.4 - Prob. 21AYPCh. 17.4 - Prob. 22AYPCh. 17.4 - Prob. 23AYPCh. 17.4 - What two ways can a membrane-bound receptor use to...Ch. 17.4 - Explain how the hormone-receptor complex can alter...Ch. 17.4 - List four intracellular mediators affected by G...Ch. 17.4 - Prob. 27AYPCh. 17.4 - Prob. 28AYPCh. 17.4 - Prob. 29AYPCh. 17.4 - Prob. 30AYPCh. 17 - Prob. 1RACCh. 17 - Prob. 2RACCh. 17 - Which of these can regulate the secretion of a...Ch. 17 - Prob. 4RACCh. 17 - Prob. 5RACCh. 17 - Concerning the half-lifeof hormones, a....Ch. 17 - Prob. 7RACCh. 17 - Prob. 8RACCh. 17 - Prob. 9RACCh. 17 - Prob. 10RACCh. 17 - Prob. 11RACCh. 17 - Which of these can limit a cell's response to a...Ch. 17 - Prob. 13RACCh. 17 - Prob. 14RACCh. 17 - When a hormone binds to a nuclear receptor a. DNA...Ch. 17 - Prob. 16RACCh. 17 - Prob. 1CTCh. 17 - Prob. 2CTCh. 17 - Prob. 3CTCh. 17 - Prob. 4CTCh. 17 - Prob. 5CTCh. 17 - Prob. 6CTCh. 17 - Thyroid hormones are important in regulating the...Ch. 17 - Prob. 8CTCh. 17 - Prob. 9CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Great Glands - Your Endocrine System: CrashCourse Biology #33; Author: CrashCourse;https://www.youtube.com/watch?v=WVrlHH14q3o;License: Standard Youtube License