Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 3IQ
Using different colors for heavy (parental) and light (new) strands of DNA, sketch the DNA molecules formed in two replication cycles after E. coli were moved from medium containing 15N to medium containing 14N. She the resulting density bands in the centrifuge tubes.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in cultures of E. coli and equilibrium density gradient centrifugation. Draw pictures to represent the bands produced by bacterial DNA in the centrifuge tube before the switch to medium containing 14N and after one, two, and three rounds of replication in that medium. Use separate sets of drawings to show the bands that would appear if replication were (a) semiconservative; (b) conservative; (c) dispersive.
A DNA strand was sequenced using the Sanger method
(https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction
tube contained the DNA strand, fluorescently labelled
dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green,
ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA
polymerase, or its Klenow fragment. Synthesis of DNA is allowed to
proceed, and the results are shown on the right:
15
14
13
12
11
10
(a) What is the sequence of the copy and the template strands?
(b) If the template strand were in the 5'-3' direction, what will be
the sequence of the DNA copy?
Nucleotide Length
Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA replication were conservative in one cycle of replication/in three cycles? How aboutdispersive replication in one cycle, in three cycles?
Chapter 16 Solutions
Study Guide for Campbell Biology
Ch. 16 - Hershey and Chase devised an experiment using...Ch. 16 - Review the structure of DNA by labeling the...Ch. 16 - Using different colors for heavy (parental) and...Ch. 16 - Look back to Interactive Question 16.2 and label...Ch. 16 - In this diagram of bacterial DNA replication,...Ch. 16 - Draw the last Okazaki fragment being formed on the...Ch. 16 - List the successive levels of packing in a...Ch. 16 - Prob. 1SYKCh. 16 - Prob. 2SYKCh. 16 - One of the reasons most scientists thought...
Ch. 16 - Transformation involves a. the uptake of external...Ch. 16 - Prob. 3TYKCh. 16 - Which of the following most closely represents...Ch. 16 - Prob. 5TYKCh. 16 - Prob. 6TYKCh. 16 - In their classic experiment, Meselson and Stahl a....Ch. 16 - The joining of nucleotides in the polymerization...Ch. 16 - DNA polymerase is not able to begin copying a DNA...Ch. 16 - Prob. 10TYKCh. 16 - Prob. 11TYKCh. 16 - Prob. 12TYKCh. 16 - Which of the following is least related to the...Ch. 16 - Prob. 14TYKCh. 16 - Prob. 15TYKCh. 16 - Prob. 16TYKCh. 16 - Prob. 17TYKCh. 16 - Which of the following statements about telomeres...Ch. 16 - You are trying to test your hypothesis that DNA...Ch. 16 - Given the experimental procedure explained in...Ch. 16 - Prob. 21TYKCh. 16 - Biologists have learned from the technique of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Escherichia coli chromosome is a circular DNA molecule and contains a single origin of replication. List the mechanistic steps that can terminate the movement of replication forks in this chromosome.arrow_forwardThere are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).arrow_forwardUse the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy. There are NO sites where multiple enzymes cut. How many base pairs long is the plasmid? 3kb 2kb 4kb 5kbarrow_forward
- Escherichia coli's chromosome has a replication origin called OriC. Draw a schematic diagram to show the specific DNA sequences that is essential for replication function scattering over a 245 base pair of Oric region.arrow_forwardA Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacterium. This bacterium takes 30 min to complete a round of replication at 37° C. Figure 2.1 shows the autoradiography of the replicating DNA molecule. В A C D Figure 2.1 (i) Based on the autoradiography structure (Figure 2.1), identify the point where replication in this bacterium could terminate.arrow_forwardOn paper, replicate the following segment of DNA: (UPLOAD PHOTO OF YOUR ANSWER) 5' ATCGGCTACGITCAC 3' 3'TAGCCGATGCAA GTG 5'arrow_forward
- An alternative to semi-conservative replication is conservative replication in which the parent strands come apart only temporarily to serve as templates for synthesis of daughter strands but then come back together again as they were originally and the two new daughter strands then also form a duplex molecule. What single feature of the Meselsohn Stahl experiment allowed this conservative replication hypothesis to be rejected? (Hint:To answer this question you can consider the banding pattern produced on the cesium chloride density-gradient centrifugation following one round of replication in the Meselsohn Stahl experiment.)arrow_forwardIndicate the proteins involved in the following steps of DNA replication in E. coli a. ___________ initiator of replication by binding to the origin of replication of the prokaryote ___________ a dimer that unzips the DNA helix ___________ an enzyme responsible for relieving positive supercoils ahead of replication fork ___________ maintains DNA in single-stranded state ___________ primary replicating enzyme ___________ synthesizes RNA primers The resulting gap by removal of RNA primer is filled in by ___________. h. the resulting nick is sealed by _____________.arrow_forwardBelow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.arrow_forward
- Approximately how many high-energy bonds does DNA polymerase use to replicate a bacterial chromosome (ignoring helicase and other enzymes associated with the replication fork)? compared with its own dry weight of 10–12 g, how much glucose does a single bacterium need to provide enough energy to copy its DNA once?arrow_forwardA scientist successfully analyzed a new micro-organism. Because this micro-organism contains double-stranded DNA as genetic material, Meselson-Stahl techniques was employed. The following shows the results of the experiment where L – light chain (14N) and H – heavy chain (15N).What is the mechanism of replication in this organism in the picture? Explain how you got the answer. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. What is the sequence of the daughter strand produced from this sequencing activity? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. How many bands will appear in the lane containing ddATP? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’.…arrow_forwardUsing the same experimental setup as in the original Meselson and Stahl experiment, predict the bands (heavy, light or intermediate) that you would observe after one round of replication if DNA polymerase replicated the bacterial genome by the conservative model of replication. Draw and explain your prediction.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY