Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 4TYK
Which of the following most closely represents Chargaff’s rule?
- a. A pairs with T and C pairs with G
- b. %A + %T = %C + %G
- c. %A + %G = %C + %T
- d. Strands in a DNA double helix are antiparallel.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following relations will be found in the percentages of bases of a double-stranded DNA
molecule?
a. A+T-G+C
b. A+G=T+C
A+C-G+T
c.
d. (A +T)/ (C+G) = 1.0
e. (A+G)/ (C+T)= 1.0
f. (A/C)=(G/T)
g. (A/G)=(T/C)
h. (A/T)=(G/C)
Use Chargaff's Rule to determine the percentage of base T in a sample of DNA that is 28% A and 22% C.
O 22% T
28% T
44%
50%
56%
In an analysis of the number of different bases in a DNA sample, which
result would be consistent with the base-pairing rules? *
A+T>G+C
O AC+T
Chapter 16 Solutions
Study Guide for Campbell Biology
Ch. 16 - Hershey and Chase devised an experiment using...Ch. 16 - Review the structure of DNA by labeling the...Ch. 16 - Using different colors for heavy (parental) and...Ch. 16 - Look back to Interactive Question 16.2 and label...Ch. 16 - In this diagram of bacterial DNA replication,...Ch. 16 - Draw the last Okazaki fragment being formed on the...Ch. 16 - List the successive levels of packing in a...Ch. 16 - Prob. 1SYKCh. 16 - Prob. 2SYKCh. 16 - One of the reasons most scientists thought...
Ch. 16 - Transformation involves a. the uptake of external...Ch. 16 - Prob. 3TYKCh. 16 - Which of the following most closely represents...Ch. 16 - Prob. 5TYKCh. 16 - Prob. 6TYKCh. 16 - In their classic experiment, Meselson and Stahl a....Ch. 16 - The joining of nucleotides in the polymerization...Ch. 16 - DNA polymerase is not able to begin copying a DNA...Ch. 16 - Prob. 10TYKCh. 16 - Prob. 11TYKCh. 16 - Prob. 12TYKCh. 16 - Which of the following is least related to the...Ch. 16 - Prob. 14TYKCh. 16 - Prob. 15TYKCh. 16 - Prob. 16TYKCh. 16 - Prob. 17TYKCh. 16 - Which of the following statements about telomeres...Ch. 16 - You are trying to test your hypothesis that DNA...Ch. 16 - Given the experimental procedure explained in...Ch. 16 - Prob. 21TYKCh. 16 - Biologists have learned from the technique of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The helix of an A-DNA differs from the helix of a B-DNA in all of the following EXCEPT which phrase? a. polarity of the strands b. thickness of the helix c. tilt of the bases d. appearance of the major and minor groovearrow_forwardA. #1 B. #2 C. #3 D. #4arrow_forwardWhich repeating sequence below would you expect to find on the end of the longest DNA strand of a chromsome (select one)? A. 5'-TTTTTT-3' B. 5'-TTAGGG-3' C. 5'-CCCTAA-3' D. 5'-AAAAAA-3' E. 5'-GGATCC-3'arrow_forward
- Match the following type of DNA repair mechanism with the most appropriate definition. Nucleotide excision repair Homologous recombination Base excision repair Nonhomologous end joining A. Repairs thymine dimers by removing a section of the strand B. Corrects damaged bases by removing only the base C. Repairs double strand breaks by joining the ends D. Repairs double strand breaks by copying second chromosomearrow_forwardThe following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forwardIf a virus particle contained double-stranded B-DNA of 400,000 base pairs, A. How many complete helical turns would occur on each strand? B. How many atoms of phosphorus would be present? C. If the mole % of G in this genome is 17%, what is the mole % of A?arrow_forward
- Four enzymes are listed below, match each to the correct definition. Definition Enzyme 4. Ligase 5. Primase 6. Gyrase 7. Helicase Answer a. Unwinds DNA b. Relieves tension in DNA during unwinding c. Links sugars and phosphates together d. Builds RNA primers C В Aarrow_forward1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocityarrow_forwardGive the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’arrow_forward
- What describes or designates the 3' end of a DNA strand? a. an available hydroxyl group on the 5th carbon of a deoxyribose of a terminal nucleotide b. an available phosphate group on the 3rd carbon of a deoxyribose of a terminal nucleotide c. an available hydroxyl group on the 3rd carbon of a deoxyribose of a terminal nucleotide d. an available hydroxyl group on the 2nd carbon of a deoxyribose of a terminal nucleotidearrow_forwardWhich of the following describes a Z-DNA helix? a. It is inhibited by methylation of bases b. It is favored by alternating GC sequence c. It has fewer base pairs per turn than the B-DNA d. It is favored in many solutions that are relatively devoid of waterarrow_forwardEthidium Bromide is a chemical reagent that has been used to detect the presence of nucleic acids. It is known to fluoresce under UV light and the intensity of the fluoresence increases when it binds to the nucleic acids. Ethidium Bromide binds to polynucleotides a by binding directly to the bases on one of the strands. b by intercalating itself between the base pair stacks. c through the negatively charged phosphate groups. d through the hydroxyl group of the sugar molecule.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license