
Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 15.11, Problem 1MQ
- Describe the energy and carbon
metabolism of Thiobacillus in terms of how ATP and new cell material are made.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 15 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 15.1 - Why is it necessary to consider microbial...Ch. 15.1 - What are three reasons that functional traits...Ch. 15.1 - What is convergent evolution and how is it...Ch. 15.2 - What form of photosynthesis was most likely the...Ch. 15.2 - Which bacterial phyla contain phototrophs?Ch. 15.3 - What are the differentiating properties of the...Ch. 15.3 - Prob. 2MQCh. 15.3 - How are prochlorophytes, such as Prochlorococcus,...Ch. 15.4 - What is the source of the purple color from which...Ch. 15.4 - Prob. 2MQ
Ch. 15.4 - Compare and contrast the metabolism, morphology,...Ch. 15.5 - What are some similarities between purple...Ch. 15.5 - Prob. 2MQCh. 15.5 - Compare and contrast the metabolism of purple...Ch. 15.6 - Prob. 1MQCh. 15.6 - Prob. 2MQCh. 15.6 - Prob. 1CRCh. 15.7 - Prob. 1MQCh. 15.7 - Prob. 2MQCh. 15.7 - Prob. 1CRCh. 15.8 - What types of anoxygenic phototrophs contain...Ch. 15.8 - Prob. 2MQCh. 15.8 - In what ways is Chloracidobacterium thermophilum...Ch. 15.9 - What are the typical electron donors used by...Ch. 15.9 - What bacterial phyla are known to contain...Ch. 15.9 - Prob. 1CRCh. 15.10 - What are the typical electron donors used by...Ch. 15.10 - Prob. 2MQCh. 15.10 - In what ways are sulfur-reducing bacteria...Ch. 15.11 - Describe the energy and carbon metabolism of...Ch. 15.11 - What are some ecological strategies that sulfur...Ch. 15.11 - Prob. 1CRCh. 15.12 - What mechanisms do free-living diazotraphs use to...Ch. 15.12 - Prob. 2MQCh. 15.12 - What are some ways that diazotrophs protect...Ch. 15.13 - Under what conditions would you expect...Ch. 15.13 - Prob. 2MQCh. 15.13 - Prob. 1CRCh. 15.14 - In what phylogenetic groups are Geobacter and...Ch. 15.14 - Prob. 2MQCh. 15.14 - Prob. 1CRCh. 15.15 - What habitat characteristics govern the diversity...Ch. 15.15 - How do aerobic neutrophilic iron-oxidizers keep...Ch. 15.15 - Prob. 1CRCh. 15.16 - What is the difference between a methanotroph and...Ch. 15.16 - What is unique about the methanotroph...Ch. 15.16 - What are the differences between type I and type...Ch. 15.17 - Prob. 1MQCh. 15.17 - What are the different ways in which species of...Ch. 15.17 - Compare and contrast the life cycle of Myxococcus...Ch. 15.18 - Prob. 1MQCh. 15.18 - Prob. 2MQCh. 15.18 - Prob. 1CRCh. 15.19 - What are the major differences between spirochetes...Ch. 15.19 - Name two diseases of humans caused by spirochetes.Ch. 15.19 - Contrast the motility of spirochetes with that of...Ch. 15.20 - Prob. 1MQCh. 15.20 - Prob. 2MQCh. 15.20 - Contrast the life cycle of Hyphomicrobium with...Ch. 15.21 - Describe how a sheathed bacterium such as...Ch. 15.21 - List two metals that are oxidized by sheathed...Ch. 15.21 - In what environment might you expect to find...Ch. 15.22 - What benefit do magnetic bacteria accrue from...Ch. 15.22 - Would you expect to find greigite or magnetite in...Ch. 15.22 - In what way does a magnetosome contribute to the...Ch. 15 - Describe a key physiological feature of the...Ch. 15 - Describe the metabolism for each of the following...Ch. 15 - Using an example from each of the morphologically...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning


Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biochemical Tests-Part 1; Author: Southern Stacker;https://www.youtube.com/watch?v=a-i9vANfQWQ;License: Standard Youtube License