Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14, Problem 17TYU
Summary Introduction
To suggest: The reason why gene regulatory elements have not undergone many changes during the course of evolution.
Introduction: Gene regulation consists of many mechanisms that the cell uses to decrease or increase the production of certain gene products. The gene regulation in the bacteria mainly takes place in the level of transcription. In the eukaryotes, the gene regulation takes place in the level of transcription, post transcription, translation, and post translation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Comparing DNA sequences in different species indicates that more DNA segments that do not code for protein have been conserved (unchanged) than protein- coding regions. These non-protein-coding regions areinterpreted as gene regulatory elements. Suggest why gene regulatory elements have not undergone many changes during the course of evolution.
Your friend has discovered that the same human promoter is responsible for producing two different proteins. In Kidney cells it is responsible for the production of protein A while in Brain cells it is responsible for the production of Protein B. Your friend has concluded that this promoter must be controlling two different genes. Do you agree or disagree with your friend's conclusion? Explain why or why not. Be sure to describe the molecular events to support your answer.
Histone proteins are among the most highly conserved proteins in eukaryotes. histone h4 proteins from a pea and a cow, for example, differ in only 2 of 102 amino acids. Comparison of the gene sequences shows many more differences, but only two change the amino acid sequence. These observations indicate that mutations that change amino acids must have been selected against during evolution. Why do you suppose that amino- acid-altering mutations in histone genes are deleterious?
Chapter 14 Solutions
Biology (MindTap Course List)
Ch. 14.1 - Explain why bacterial and eukaryotic cells have...Ch. 14.1 - Prob. 1CCh. 14.1 - Prob. 2CCh. 14.2 - Prob. 2LOCh. 14.2 - Distinguish among inducible, repressible, and...Ch. 14.2 - Differentiate between positive and negative...Ch. 14.2 - Prob. 5LOCh. 14.2 - Prob. 1CCh. 14.2 - What structural features does the trp operon share...Ch. 14.2 - Prob. 3C
Ch. 14.2 - Prob. 4CCh. 14.3 - Prob. 6LOCh. 14.3 - Give examples of some of the ways eukaryotic...Ch. 14.3 - Prob. 8LOCh. 14.3 - Prob. 9LOCh. 14.3 - Prob. 10LOCh. 14.3 - Prob. 1CCh. 14.3 - Prob. 2CCh. 14.3 - Prob. 3CCh. 14.3 - Prob. 4CCh. 14.3 - Prob. 5CCh. 14 - The regulation of most bacterial genes occurs at...Ch. 14 - Prob. 2TYUCh. 14 - Prob. 3TYUCh. 14 - Prob. 4TYUCh. 14 - Inactive genes tend to be found in (a) highly...Ch. 14 - Prob. 6TYUCh. 14 - Which of the following is characteristic of genes...Ch. 14 - Through alternative splicing, eukaryotes (a)...Ch. 14 - A mutation that inactivates the repressor gene of...Ch. 14 - Which of the following is an example of positive...Ch. 14 - Prob. 11TYUCh. 14 - PREDICT Compare the types of bacterial genes...Ch. 14 - INTERPRET DATA Develop a simple hypothesis that...Ch. 14 - Prob. 14TYUCh. 14 - Prob. 15TYUCh. 14 - EVOLUTION LINK Suggest why evolution resulted in...Ch. 14 - Prob. 17TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The protein produced by the gene represented in Figure 4 participates in the development of two body structures: the mouth and the pelvis. During the adult stage of this organisms the gene is turned off by histones. However, if any organism suffers an injury in the mouth, the gene becomes active again and participates in the wound healing process. Briefly explain a molecular mechanism that could allow the organisms to turn on this gene again. FIGURE 4: Regulatory sequence Regulatory sequence Enhancer 1 Isilencer Open reading frame Enhancer 2 /silencer Promoter S'UTR JUTR Proximal Core Start Stop Terminator DNA TATA Exon 1 Exon 3 Exon 2 intron Intronarrow_forwardA molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired genearrow_forwardYou are interested in finding out the function of a particular gene in the mouse genome. You have determined the nucleotide sequence of the gene, defined the portion that codes for its protein product, and searched the relevant database for similar sequences; however, neither the gene nor the encoded protein resembles anything previously described. What types of additional information about the gene and the encoded protein would you like to know in order to narrow down its function, and why?arrow_forward
- Molecular Biology is the Course RNAi is a commonly used lab technique to transiently reduce expression of a specific gene. Like many molecular biology techniques this is adapted from an already existing system that evolved for a very different purpose. What is the likely biological origin of the RNAi system and how does it effectively perform that specific function? Make sure you are specifically addressing how this system completes the function you identify for its origin. Don’t just give a general explanation of the process.arrow_forward. a. If you found a zinc-finger domain (which facilitates DNA binding) in a newly identified gene,what kinds of hypotheses could you make aboutthe gene’s function?b. Suppose that this newly identified gene shares ahigh percentage of similarity throughout its lengthwith a previously characterized gene in the sameorganism. What does this fact suggest about the origin of the two genes? Would you categorize thesegenes as being: (i) homologous, (ii) paralogous, or(iii) orthologous? (More than one answer may apply.)arrow_forwardSuppose that an investigative team conducted an RNA-Seq experiment on mouse liver cells. They found many sequences that contained no long stretches of consecutive triplet codons that could be translated into a protein. Such sequences are called open reading frames (ORFS) and suggest the presence of a gene. Which statement explains why the experiment detected long stretches with no ORFS? O The reaction solution did not include the correct primer for the gene sequence. The results suggest that the cells may be cancerous. Site-directed mutagenesis during cloning altered the ORF sequences. The RNA-Seq experiment detected noncoding RNA molecules.arrow_forward
- You are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the allele carrying this mutation have a kinky tail phenotype. You identify the gene that the mutation affects and find that the codon that encodes the second amino acid in the predicted protein has been mutated to a stop codon. Would you characterize this mutation as a loss-of-function or a gain-of-function and what specific subtype (hypermorphic, antimorphic, etc. ) within these categories? Explain your reasoning.”arrow_forwardAn analysis of the human genome revealed that some regions of DNA that are highly conserved across species do not code for proteins. Propose an explanation for why these noncoding regions are conserved and what this could mean in terms of evolution.arrow_forwardExplain why many traits encoded by mtDNA and cpDNA exhibit considerable variation in their expression, even among members of the same family.arrow_forward
- Using a computer algorithm that searches for sequence similarities in other organisms, you discover that hexose kinase is a highly conserved gene that is expressed by many species, both prokaryotic and eukaryotic. The most closely related prokaryotic homolog of hexose kinase has a protein sequence in which 90% of the amino acids are identical to those of the human version of the gene. To learn more about their similarity at the DNA level, you obtain segments of the genomic DNA coding for the hexose kinase gene in both humans and this prokaryotic species. After combining both DNA samples, you heat them to denature the DNA strands and then allow them to cool and reanneal. Finally, you examine the DNA hybrids you obtain under the electron microscope. Your analysis reveals that there are three different DNA hybrids in this sample, these can be seen below. You reason that one must belong to the prokaryotic species, one to the humans and the third arose when one strand from each species base…arrow_forwardSuppose that a consensus sequence in the regulatory promotor of a eukaryotic gene that encodes an enzyme – let's call it finalexamase – was deleted. Which of the following effects would result from this deletion? (yes or no) 1. Finalexamase would have a different amino acid sequence. (yes or no)? 2. The mRNA for finalexamase would be abnormally short. (yes or no)? 3. Finalexamase would be missing some amino acids. (yes or no)? 4. The mRNA for finalexamase would be transcribed but not translated. (yes or no)? 5. The quantity of mRNA for finalexamase that is transcribed would be affected. (yes or no)?arrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License