Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14.3, Problem 6LO
Summary Introduction
To describe: The structure of a typical eukaryotic gene and DNA elements involved in regulating that gene.
Introduction: A gene is a set of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Explain the Structure and expression of a typical eukaryotic gene.
Provide a detailed description of gene expression and control in prokaryotes. Provide a detailed description of proteins critical for this process. (please hand draw a figure showing gene expression and control in prokaryotes and the proteins involved)
Contrast the characteristics of prokaryotic and eukaryotic genes. What are the implications for transcription, protein translation and gene regulation?
Chapter 14 Solutions
Biology (MindTap Course List)
Ch. 14.1 - Explain why bacterial and eukaryotic cells have...Ch. 14.1 - Prob. 1CCh. 14.1 - Prob. 2CCh. 14.2 - Prob. 2LOCh. 14.2 - Distinguish among inducible, repressible, and...Ch. 14.2 - Differentiate between positive and negative...Ch. 14.2 - Prob. 5LOCh. 14.2 - Prob. 1CCh. 14.2 - What structural features does the trp operon share...Ch. 14.2 - Prob. 3C
Ch. 14.2 - Prob. 4CCh. 14.3 - Prob. 6LOCh. 14.3 - Give examples of some of the ways eukaryotic...Ch. 14.3 - Prob. 8LOCh. 14.3 - Prob. 9LOCh. 14.3 - Prob. 10LOCh. 14.3 - Prob. 1CCh. 14.3 - Prob. 2CCh. 14.3 - Prob. 3CCh. 14.3 - Prob. 4CCh. 14.3 - Prob. 5CCh. 14 - The regulation of most bacterial genes occurs at...Ch. 14 - Prob. 2TYUCh. 14 - Prob. 3TYUCh. 14 - Prob. 4TYUCh. 14 - Inactive genes tend to be found in (a) highly...Ch. 14 - Prob. 6TYUCh. 14 - Which of the following is characteristic of genes...Ch. 14 - Through alternative splicing, eukaryotes (a)...Ch. 14 - A mutation that inactivates the repressor gene of...Ch. 14 - Which of the following is an example of positive...Ch. 14 - Prob. 11TYUCh. 14 - PREDICT Compare the types of bacterial genes...Ch. 14 - INTERPRET DATA Develop a simple hypothesis that...Ch. 14 - Prob. 14TYUCh. 14 - Prob. 15TYUCh. 14 - EVOLUTION LINK Suggest why evolution resulted in...Ch. 14 - Prob. 17TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe the characteristics of a eukaryotic promoter for a protein-encoding gene.arrow_forwardConsider the generalized structure of a eukaryotic gene, and the RNA it encodes. Of the options listed below, which one set of features determines the length of the primary RNA in base pairs, before any processing has occurred? The exon and intron sequences The promoter and enhancer sequences The start and stop codons for translation The transcription start and termination sequencesarrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forward
- Describe the similarities and differences between prokaryotic and eukaryotic promoter sequences.arrow_forwarda) Define the term gene expression b) State 4 difference between prokaryotes and eukaryotes gene expression c) state the importance of regulating gene expressionarrow_forwardGive examples of structural motifs found in transcription factors that interact with other proteins instead of DNA.arrow_forward
- A) List the steps for gene expression in prokaryotes and eukaryotes. B) Relate the differences in gene expression between prokaryotes and eukaryotes in gene expression regulation and explain what causes those differences.arrow_forwardDescribe four differences between prokaryotic and eukaryotic gene expression.arrow_forwardExplain the process of transcription in prokaryotes, including the following: promoter region, RNA polymerase, 5’-3’ direction, free nucleoside triphosphates, complementary base pairing, terminator region.arrow_forward
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwardFor each of the following, identify whether that sequence or feature of a typical protein-coding gene would be recognizable in the specified molecule in a typical prokaryotic cell. 5' UTR in DNA? 5' UTR in mRNA? Shine-Dalgarno in DNA? Shine-Dalgarno in polypeptide? Promoter in RNA? Promoter in polypeptide sequence? Stop codon in mRNA? Stop codon in the polypeptide sequence? [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] > <arrow_forwardGene X codes for a protein in eukaryotes. A mutated eukaryotic cell contains an altered base-pair in an intron of gene X. Which would be the most likely effect of this mutation on the biomolecules in the cell? The amount of pre-mRNA transcribed from gene X would be less than normal. The amount of functional protein corresponding to gene X would be less than normal. The ability of snRNAs to form a spliceosome would be diminished. The breakdown of mature mRNA corresponding to gene X would be fasterarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license