Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14.3, Problem 4C
Summary Introduction
To draw: A simple sketch illustrating how alternate splicing can give rise to different proteins.
Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Please help asap
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC
Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?
Match each of the following examples with the hypothesis it argues against.
Example
The gene coding for keratin
A gene coding for a tRNA
Three genes, each coding for one of the G protein
subunits (a, ß and y)
A gene that undergoes alternative splicing
Hypothesis
One gene → one polypeptide
One gene→→ one enzyme
One gene → one protein
One gene → one protein
Chapter 14 Solutions
Biology (MindTap Course List)
Ch. 14.1 - Explain why bacterial and eukaryotic cells have...Ch. 14.1 - Prob. 1CCh. 14.1 - Prob. 2CCh. 14.2 - Prob. 2LOCh. 14.2 - Distinguish among inducible, repressible, and...Ch. 14.2 - Differentiate between positive and negative...Ch. 14.2 - Prob. 5LOCh. 14.2 - Prob. 1CCh. 14.2 - What structural features does the trp operon share...Ch. 14.2 - Prob. 3C
Ch. 14.2 - Prob. 4CCh. 14.3 - Prob. 6LOCh. 14.3 - Give examples of some of the ways eukaryotic...Ch. 14.3 - Prob. 8LOCh. 14.3 - Prob. 9LOCh. 14.3 - Prob. 10LOCh. 14.3 - Prob. 1CCh. 14.3 - Prob. 2CCh. 14.3 - Prob. 3CCh. 14.3 - Prob. 4CCh. 14.3 - Prob. 5CCh. 14 - The regulation of most bacterial genes occurs at...Ch. 14 - Prob. 2TYUCh. 14 - Prob. 3TYUCh. 14 - Prob. 4TYUCh. 14 - Inactive genes tend to be found in (a) highly...Ch. 14 - Prob. 6TYUCh. 14 - Which of the following is characteristic of genes...Ch. 14 - Through alternative splicing, eukaryotes (a)...Ch. 14 - A mutation that inactivates the repressor gene of...Ch. 14 - Which of the following is an example of positive...Ch. 14 - Prob. 11TYUCh. 14 - PREDICT Compare the types of bacterial genes...Ch. 14 - INTERPRET DATA Develop a simple hypothesis that...Ch. 14 - Prob. 14TYUCh. 14 - Prob. 15TYUCh. 14 - EVOLUTION LINK Suggest why evolution resulted in...Ch. 14 - Prob. 17TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- VISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.arrow_forwardDescribe alternating splicing and its biological significance with a specific example.arrow_forwardTopic: Splicing a. What is the big picture of splicing and what is the importance of this concept in biology?b. What are the processes that are controlled or regulated or affected by this concept and why must these processes be controlled or regulated in the first place?arrow_forward
- asap please A partially filled diagram of eukaryotic gene structure is shown below. Label the following additional elements in the empty boxes. One label must be used twice: a) 3'UTR, b) 5'UTR, c) exon, d) intron, e) promoterarrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardDescribe the mechanisms in which DNA is used to generate protein. Reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.arrow_forward
- Pls Provide what is being asked in the picture givenarrow_forwardBioarrow_forward. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?arrow_forward
- Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?arrow_forwardGene Expression: 14) Look at the diagram: a) For each of the molecules in the diagram, identify what type of molecule they are, and label their ends (3',5',N,C). b) For each arrow, name the process and identify the major enzymes involved. c) Where do each of these activities take place in a bacterial cell? In a eukaryotic cell? Draw a picture if it helps you explain it.arrow_forwardExplain the term splicing?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY