Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14.3, Problem 4C
Summary Introduction
To draw: A simple sketch illustrating how alternate splicing can give rise to different proteins.
Introduction: In eukaryotes, transcription occurs in the nucleus, and pre-mRNA is synthesized. This pre-mRNA is further modified before translation in the cytoplasm. This is known as RNA processing. It includes the modification of mRNA ends and RNA splicing. During RNA splicing, the non-coding regions, that is introns, are excised from the RNA molecules, and the coding regions are joined.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Please help asap
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC
Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?
1Need help:. draw valine-aminoacyl tRNA synthetase. Show the
tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw
the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme.
Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes
in every cell.
Chapter 14 Solutions
Biology (MindTap Course List)
Ch. 14.1 - Explain why bacterial and eukaryotic cells have...Ch. 14.1 - Prob. 1CCh. 14.1 - Prob. 2CCh. 14.2 - Prob. 2LOCh. 14.2 - Distinguish among inducible, repressible, and...Ch. 14.2 - Differentiate between positive and negative...Ch. 14.2 - Prob. 5LOCh. 14.2 - Prob. 1CCh. 14.2 - What structural features does the trp operon share...Ch. 14.2 - Prob. 3C
Ch. 14.2 - Prob. 4CCh. 14.3 - Prob. 6LOCh. 14.3 - Give examples of some of the ways eukaryotic...Ch. 14.3 - Prob. 8LOCh. 14.3 - Prob. 9LOCh. 14.3 - Prob. 10LOCh. 14.3 - Prob. 1CCh. 14.3 - Prob. 2CCh. 14.3 - Prob. 3CCh. 14.3 - Prob. 4CCh. 14.3 - Prob. 5CCh. 14 - The regulation of most bacterial genes occurs at...Ch. 14 - Prob. 2TYUCh. 14 - Prob. 3TYUCh. 14 - Prob. 4TYUCh. 14 - Inactive genes tend to be found in (a) highly...Ch. 14 - Prob. 6TYUCh. 14 - Which of the following is characteristic of genes...Ch. 14 - Through alternative splicing, eukaryotes (a)...Ch. 14 - A mutation that inactivates the repressor gene of...Ch. 14 - Which of the following is an example of positive...Ch. 14 - Prob. 11TYUCh. 14 - PREDICT Compare the types of bacterial genes...Ch. 14 - INTERPRET DATA Develop a simple hypothesis that...Ch. 14 - Prob. 14TYUCh. 14 - Prob. 15TYUCh. 14 - EVOLUTION LINK Suggest why evolution resulted in...Ch. 14 - Prob. 17TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- VISUALIZE Sketch a simple flow diagram that shows the relationships among the following: RNA, translation, DNA, transcription, and polypeptide.arrow_forwardMatch each of the following examples with the hypothesis it argues against. Example The gene coding for keratin A gene coding for a tRNA Three genes, each coding for one of the G protein subunits (a, ß and y) A gene that undergoes alternative splicing Hypothesis One gene → one polypeptide One gene→→ one enzyme One gene → one protein One gene → one proteinarrow_forwardDescribe alternating splicing and its biological significance with a specific example.arrow_forward
- Topic: Splicing a. What is the big picture of splicing and what is the importance of this concept in biology?b. What are the processes that are controlled or regulated or affected by this concept and why must these processes be controlled or regulated in the first place?arrow_forwardusing example what is a degenerate primer? with the aid of diagrams discuss how degenerate primers are used to introduce random mutations in a gene and list some advantages and disadvantages of generating modified protein by this method .arrow_forwardConsider the CT/CGRP example of alternative splicing. Which different types of alternative splicing patterns are represented?arrow_forward
- Explain alternative splicing Please explain in 5 sentences or less, thank you!arrow_forwardGive typing answer with explanation and conclusion a) List three eukaryotic gene expression mechanisms that do not occur in prokaryotes. For two of these, give specific examples and the functional outcomes. b) Describe what is meant by the term “RNA silencing”. c) Using diagrams, give two examples of RNA silencing mechanisms and indicate one difference.arrow_forwardIn your own wordsarrow_forward
- Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino acid sequence of a protein can be deduced by applying the genetic code. thus, protein biochemistry has become superfluous because there is nothing more that can be learned by studying the protein.”arrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardExplain all options. Which option is correct and why ?? Asaparrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY