Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14, Problem 14TYU
Summary Introduction
To determine: The reason why rate of transcription of gene is decreased when DNA that is situated several thousand bases upstream from the gene is removed.
Introduction: Gene regulation consists of many mechanisms that the cell uses to decrease or increase the production of certain gene products. The gene regulation in the bacteria mainly takes place in the level of transcription. In the eukaryotes, the gene regulation takes place in the level of transcription, post transcription, translation, and post translation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Consider the generalized structure of a eukaryotic gene, and the RNA it encodes. Of the options listed below, which one set of features determines the length of the primary RNA in base pairs, before any processing has occurred?
The exon and intron sequences
The promoter and enhancer sequences
The start and stop codons for translation
The transcription start and termination sequences
Computer programmers, working with molecular geneticists, have developed programs that can identify genes within long stretches of DNA sequence. Imagine that you are working with a programmer on such a project. On the basis of what you know about the process of transcription, what sequences should the program use to identify the beginning and end of a gene?
Here is a schematic map with a scale of a eukaryotic gene.
How long is the primary mRNA transcript produced from this gene?
Termination
Start codon
Stop codon
sequence
-35 -10
Exon 1
Intron 1
Exon 2
Intron 2
Exon 3
3
4
Genomic sequence (kb) (k = kilo = 1,000)
%3D
5000 bases
4200 bases
3200 bases
4800 bases
Chapter 14 Solutions
Biology (MindTap Course List)
Ch. 14.1 - Explain why bacterial and eukaryotic cells have...Ch. 14.1 - Prob. 1CCh. 14.1 - Prob. 2CCh. 14.2 - Prob. 2LOCh. 14.2 - Distinguish among inducible, repressible, and...Ch. 14.2 - Differentiate between positive and negative...Ch. 14.2 - Prob. 5LOCh. 14.2 - Prob. 1CCh. 14.2 - What structural features does the trp operon share...Ch. 14.2 - Prob. 3C
Ch. 14.2 - Prob. 4CCh. 14.3 - Prob. 6LOCh. 14.3 - Give examples of some of the ways eukaryotic...Ch. 14.3 - Prob. 8LOCh. 14.3 - Prob. 9LOCh. 14.3 - Prob. 10LOCh. 14.3 - Prob. 1CCh. 14.3 - Prob. 2CCh. 14.3 - Prob. 3CCh. 14.3 - Prob. 4CCh. 14.3 - Prob. 5CCh. 14 - The regulation of most bacterial genes occurs at...Ch. 14 - Prob. 2TYUCh. 14 - Prob. 3TYUCh. 14 - Prob. 4TYUCh. 14 - Inactive genes tend to be found in (a) highly...Ch. 14 - Prob. 6TYUCh. 14 - Which of the following is characteristic of genes...Ch. 14 - Through alternative splicing, eukaryotes (a)...Ch. 14 - A mutation that inactivates the repressor gene of...Ch. 14 - Which of the following is an example of positive...Ch. 14 - Prob. 11TYUCh. 14 - PREDICT Compare the types of bacterial genes...Ch. 14 - INTERPRET DATA Develop a simple hypothesis that...Ch. 14 - Prob. 14TYUCh. 14 - Prob. 15TYUCh. 14 - EVOLUTION LINK Suggest why evolution resulted in...Ch. 14 - Prob. 17TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template. Given: GUC-CAC-UUA-ACC-CCU-GAG-GAG-AAA-UCG-GCC (Protein with known amino acid sequence) Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.arrow_forwardConsider the following segment of a template strand of DNA: Part A -ATA AGC TTC GAC- What is the mRNA produced for the segment? -UAU-UCG-AAG-CUC- Part B Complete previous part(s) • Part C What is the mRNA if a mutation changes AGC to AAC? Part D Complete previous part(s) Part E What is the MRNA produced if G is inserted at the beginning of the DNA segment?arrow_forwardMatch the term with its definition comparing genomic DNA, mRNA, and proteins. You may only use each option ONCE. where transcription starts. where translation ends a chemical group that indicates the first nucleotide that was added to the mRNA a chemical group that indicates the first amino acid that was added to the polypeptide a DNA sequence that is neither transcribed nor translated a non-protein coding region upstream of the start codon in the mRNA promoter complimentary base-pairs with the codon amino-terminus a DNA sequence that is transcribed, but not intron translated [Choose ] stop codon +1 site tRNA 5-prime UTR start codon exon 5-prime triphosphate promoter amino-terminus 5-prime triphosphate stop codonarrow_forward
- Can you please help answer the question of which image represents the exon and intron?arrow_forwardpoint: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三 囲 Y pre-MRNA:| I囲2 Larrow_forwardYou are a research scientist working in genetic engineering. You create a piece of DNA that you want to express in a mouse cell, which is a eukaryote. This piece of DNA (represented by the schematic in the figure) consists of a eukaryotic promoter, a prokaryotic gene lacking introns and exons and a eukaryotic terminator sequence. Do you think that this piece of DNA would be successfully expressed if placed into a mouse cell containing all the machinery needed for gene expression? Fully motivate your answer. The AAUAAA Eukaryotic Start Coding Stop terminator promoter codon sequence codon sequencearrow_forward
- Decode the unknown word using the genetic code and fill out the missing nucleotides. Translate the generated mRNA sequence using the universal genetic code table and the information derived from the previous steps. . determine the unknown word by arranging the single letter amino acid code of the hypothetical protein produced bound by the start and stop codon.arrow_forwardIn your own wordsarrow_forwardThe following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.arrow_forward
- Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript produced from this gene? Termination Start codon Stop codon sequence -35 -10 Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 1 2 3 4. Genomic sequence (kb) (k = kilo = 1,000) 2200 bases 3200 bases 2000 bases 4200 basesarrow_forwardThe coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forwardMatch each of the following examples with the hypothesis it argues against. Example The gene coding for keratin A gene coding for a tRNA Three genes, each coding for one of the G protein subunits (a, ß and y) A gene that undergoes alternative splicing Hypothesis One gene → one polypeptide One gene→→ one enzyme One gene → one protein One gene → one proteinarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY