BIOLOGY 2E
2nd Edition
ISBN: 9781506699851
Author: OpenStax
Publisher: XANEDU PUBLISHING
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 14, Problem 13RQ
Which of the following does the enzyme primase synthesize?
- DNA primer
- RNA primer
- Okazaki fragments
- phosphodiester linkage
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which enzymes are involved in protein translation? There are multiple answers.
Helicase
DNA polymerase
RNA polymerase
DNA ligase
single strand binding proteins
peptidyl transferase
σ unit
release factors
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA:
3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'
Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________
Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47:
mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-
polypeptide chain: ________--________--________--________--________--________--________--________
Which of the following is a nucleoside monophosphate?
GMP
Adenosine
UTP
ADPUDP
Chapter 14 Solutions
BIOLOGY 2E
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
If you wish to reduce the stress (which related to centripetal force) on high-speed tires, would you use large-...
College Physics
Write an equation that uses the products of photosynthesis as reactants and the reactants of photosynthesis as ...
Campbell Biology in Focus (2nd Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
1. Which parts of the skeleton belong to the appendicular skeleton? Which belong to the axial skeleton?
Human Anatomy & Physiology (2nd Edition)
What are the four types of tissues, and what are their characteristics?
Human Anatomy & Physiology
Give at least three examples of key ecosystem services that nature provides for people.
Campbell Biology (10th Edition)
Knowledge Booster
Similar questions
- In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forwardWhat is the polypeptide that will be formed from the following DNA sequence? Template DNA Sequence: 3' T A C T G C G T A G A C C T C 5'arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.arrow_forward
- Which of the following base-pairing rule is correct : * Adenine with guanine and thymine with cytosine DNA base pairing is non-specific Adenine with cytosine and guanine with thymine Adenine with thymine and guanine with cytosinearrow_forwardA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.arrow_forwardIndicate where each of the following processes occurs (nucleus, cytoplasm or mitochondria).Translation AnswerTranscription AnswerDNA replication Answerarrow_forward
- A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments is placed in a single well at the top of an agarose gel. Using the information given below, draw (below the well) how you think the fragments will be aligned on the gell following electrophoresis. Label each fragment with its corresponding letter. Each band on the gel will be the same width, equal to the width of the well at the top of the gell. These should be in one lane. Do smaller or larger (pb) fragments migrate the furthest? Why?arrow_forwardA piece of DNA is cut into four fragments as shown below. A solution containing the four fragments is placed in a single well at the top of an agarose gel. Using the information given below, draw (below the well) how you think the fragments will be aligned on the gel following electrophoresis. Label each fragment with its corresponding letter. Remember, each band on the gel will be the same width, equal to the width of the well at the top of the gel. These should all be in one lane. What is it about the chemistry of DNA that causes it to be uniformly negatively charged?arrow_forwardA piece of DNA is cut into four fragments as shown below. A solution containing the four fragments is placed in a single well at the top of an agarose gel. Using the information given below, draw (below the well) how you think the fragments will be aligned on the gel following electrophoresis. Label each fragment with its corresponding letter. Remember, each band on the gel will be the same width, equal to the width of the well at the top of the gel. These should all be in one lane. What if you had two different DNA fragments that were exactly the same length as measured in base-pairs. Would it be possible to distinguish them using this type of electrophoresis? How would they appear on a gel?arrow_forward
- Which kind of chemical damage is depicted in this picture: 2-OH O strand breakage O base deletion base modification base cross linkingarrow_forwardMolnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA double helix molnupiravir can base pair with more than one base. Shown below are the structures the RNA bases. With which two bases does molnupiravir pair? H N-H Adenine NH-N Uracil H H-N N-HN N-H Guanine H Cytosine A. The "imino" form pairs with A; the "amino" form pairs with G. B. The "imino" form pairs with G; the "amino" form pairs with A. C. The "imino" form pairs with U; the "amino" form pairs with C. D. The "imino" form pairs with C, the "amino" form pairs with U.arrow_forwardConsider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-Uarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College