BIOLOGY 2E
2nd Edition
ISBN: 9781506699851
Author: OpenStax
Publisher: XANEDU PUBLISHING
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 18RQ
During proofreading, which of the following enzymes reads the DNA?
- primase
- topoisomerase
- DNA pol
- helicase
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment.
Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers.
Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand).
Please organize your response so that each primer, and associated information, is separated by at least one blank line
5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
Restriction endonuclease and ligase are two types
of enzymes used in the process of genetic
engineering, i.e., the manipulation of genes. The
restriction endonuclease differs from ligase in that it
breaks the DNA at ends, while ligase causes
the breaks in DNA from interior
joins the fragments of DNA, while ligase
breaks the DNA into fragments
breaks the DNA at specific points, while the
ligase joins the fragments of DNA
breaks the DNA apart at each nucleotide,
while ligase use the pieces to translate
Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining steps needed to obtain the desired sequences (a different fournucleotide sequence on each of the four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide sequence attached at each spot.
Chapter 14 Solutions
BIOLOGY 2E
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
An object that is thrown straight up falls back to Earth. This is one-dimensional motion. (a) When is its veloc...
College Physics
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
What properties do all types of epithelia share?
Campbell Biology (10th Edition)
Body, Heal Thyself The precision of mitotic cell division is essential for repairing damaged tissues like those...
Biology: Life on Earth with Physiology (11th Edition)
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (6th Edition)
What is the difference between cellular respiration and external respiration?
Human Physiology: An Integrated Approach (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer Bankarrow_forwardDraw an Illustration of the steps and other methods involved in recombinant DNA ( Please make it clean and readable, labelled should be included).[ Drawing ]arrow_forwardAll of the following are examples of materials that are bound by your purifying medium during the DNA extraction process, except: O endoplasmic reticulum extraneous DNA O Calcium (Ca2+) O Iron (Fe2+) O Magnesium (Mg2+) O lipid membranesarrow_forward
- PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…arrow_forwardFor what purposes is DNA extraction done? (give at least 3 purposes for which you may need to extract DNA)arrow_forwardWhich of the following substances adds equivalent DNA nucleotides to the 3' end of Okazaki fragments after primers are removed? Group of answer choices helicase DNA ligase DNA polymerase I DNA polymerase IIIarrow_forward
- PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCOȚAGCTATATOCTATCOTGACOTATCOGCOCATTAAȚCGGGATCGAT 3 3' TGGCATCGATATACGATAGCACTGCATAGCCGCGTAATTAGCCCTAGCTẢ 5 50 5' AGCTCGCTAGCAGGAGAGATATCGCTCATAGCTCCGATCGATGCCGCTAA 3 100 3' TCGAGCGATCGTCCICTCTATAGCGAGTAICGAGGCTAGCTACGGCGATİ 5' 5' TATAGCTCTCTGCGGATATÇGCATẠTACCAAGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACGCCTATAGCGTATATGGÍTCCGGGATGČATACATCGAŤ 5 5' TGCGȚATATÇGGAGAGTCCTGGATAT GGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCATATAGCCTCICAGGACCTATACCTCGAACÍGACGICTCTCGAGCİ 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 250 3' ATACGCGAATCCGGCATATACGAACCCCTITCGAĞATACATACG ẢTACAČ 5' 5' TGCATOTGCTATOCAACGTTC GGATTGCGȚAGCAGTAATAGCGCCGATTO 3' 300 3'…arrow_forwardThe enzyme that removes the RNA primer from the Okazaki fragment is: DNA pol III DNA ligase DNA gyrase DNA pol Iarrow_forwardDuring a typical gel electrophoresis set up (negative pole at the top), which DNA fragment would be nearest the top after separating the DNA fragments? 10 kb 100 kb 2,500 bp 2 bparrow_forward
- Which of the following enzymes ensures that the correct base of a deoxynucleotide for growing the chain is aligned with template chain? DNA gyrases DNA ligases DNA polymerases primasesarrow_forwardDuring a PCR reaction, the step in the cycle where dNTPs are added to the primer 3’ ends to fill in the strand complementary to the template by DNA polymerase is called: Annealing Extension Hybridization Melting.arrow_forwardWhat enzyme proofreads the DNA molecule? Group of answer choices DNA gyrase DNA polymerase I DNA helicase DNA polymerase IIIarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License