Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 2AQ
For the following sequences, construct the phylogenetic tree that best depicts their evolutionary relationships.
Taxon 1: GTTCCCTTA
Taxon 2: GTTCGGTAT
Taxon 3: GAAAAACCCTAT
Taxon 4: CTTCCCTTT
Taxon 5: GTAAAACCCGAT
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Please help to creating parsimonious treesFor the following DNA sequences determine the most parsimonious phylogeny.
Tree ASpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AATGTCGGGATATATCGCGGGGAAATTTACGACTSpecies 3 AATTGCGGGATATATCGCGGGGAAATTTACGACT
Tree BSpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AACTGCGGCATATATCGCGGGGAAATTAACGACTSpecies 3 AAGTGCGCCATATATCGCCCGGATAATTTCGAGA
Tree CSpecies 1 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 2 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGCSpecies 3 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 4 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGC
Tree DSpecies 1 GGGATATAGCGCACGATATCGTAGCCTAACGTTTTACGSpecies 2 GGGATATAGCGCACGATATCGTAAGCTAACGTTTTACGSpecies 3 AAAATATAGGCGTGGATATCGTAGCCTAACGTTGCATTSpecies 4 GGGATATACCGCACGTTATCGATCCCTAACGTTTTACG
Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the
relationship between the four species: M, L, S, and R.
B
A
M
LS R
M
LR
+d
\t
R
SML
RM S
tota
-444
What is the plausible explanation for the appearance of autapomorphic character c in species L and S of
tree A although they do not share a most recent common ancestor?
Please create a phylogenetic (evolutionary) tree given this criteria and follow all points!
There are three domains of life - Bacteria, Archaea, and Eukarya.
Start by drawing these three main branches.
Then add branches for plants, animals, fungi, and protists. When adding all these branches,
don't just add them randomly. The branching pattern reflects evolutionary relationships. You
should use the relationships/branching patterns.
Then add additional branches for
• three species of bacteria
• three species of archaea
three species of plants
three species of animals
• three species of fungi
• three species of protists (single-celled eukaryotes)
You can pick any species you want. For each species, be sure to add 1 synapomorphy (shared
derived character) that defines the species or group.
•
Finally, label the tree with all the terms (parts of a tree, not phylogenetic groups) when
describing a phylogenetic tree.
Chapter 12 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 12.1 - What characteristics would have made the surface...Ch. 12.1 - How do we know when oceans were first present on...Ch. 12.1 - What lines of reasoning support the hypothesis...Ch. 12.2 - Why is the origin of cyanobacteria considered a...Ch. 12.2 - What caused the development of banded iron...Ch. 12.2 - What lines of evidence indicate that microbial...Ch. 12.3 - What evidence supports the idea that the...Ch. 12.3 - Prob. 2MQCh. 12.3 - In what ways are modern eukaryotes a combination...Ch. 12.4 - Prob. 1MQ
Ch. 12.4 - Prob. 2MQCh. 12.4 - Prob. 3MQCh. 12.5 - How are DNA sequences obtained for phylogenetic...Ch. 12.5 - What does a phylogenetic tree depict?Ch. 12.5 - Prob. 3MQCh. 12.6 - What are the different processes that give rise to...Ch. 12.6 - What is the difference between selection and...Ch. 12.6 - In the experiment of Figure 13.12, why did the...Ch. 12.7 - What is the difference between the core and pan...Ch. 12.7 - What kind of recombination might have the greatest...Ch. 12.7 - What effects do deletions have on the evolution of...Ch. 12.8 - What is the difference between taxonomy and...Ch. 12.8 - What are some key criteria from the phylogenetic...Ch. 12.8 - How many species of Bacteria and Archaea have been...Ch. 12.9 - What class of genes is used in MLST analyses?Ch. 12.9 - How is ribotyping different from rep-PCR?Ch. 12.9 - What is FAME analysis?Ch. 12.10 - What roles do culture collections play in...Ch. 12.10 - What is the IJSEM and what taxonomic function does...Ch. 12.10 - Why might viable cell cultures be of more use in...Ch. 12 - Prob. 1RQCh. 12 - Prob. 2RQCh. 12 - Prob. 3RQCh. 12 - What is the endosymbiotic hypothesis for the...Ch. 12 - Prob. 5RQCh. 12 - REVIEW QUESTIONS
6. What major physiological and...Ch. 12 - Prob. 7RQCh. 12 - Prob. 8RQCh. 12 - Prob. 9RQCh. 12 - What is the difference between a gene tree and an...Ch. 12 - Prob. 11RQCh. 12 - Prob. 12RQCh. 12 - What is fitness? To what degree does fitness...Ch. 12 - What are some processes that influence the content...Ch. 12 - Prob. 15RQCh. 12 - What is the "species problem" and why is the...Ch. 12 - Prob. 17RQCh. 12 - Prob. 18RQCh. 12 - Prob. 19RQCh. 12 - Prob. 20RQCh. 12 - Prob. 21RQCh. 12 - Compare and contrast the physical and chemical...Ch. 12 - For the following sequences, construct the...Ch. 12 - Imagine that you have been given several bacterial...Ch. 12 - Imagine that you have discovered a new form of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Referring to the phylogenetic tree shown above, answer the following questions: 1. How many OTUs are included in the phylogenetic analysis? 2. How many clades are there? 3. What is an autapomorphic trait of the domestic cat? Explain why? 4. What is the shared derived trait (synapomorphy) in the Family Felidae? Explain why?arrow_forwardThe universal phylogenetic tree of life shows the divergence of Bacteria, Archaea, and Eukarya. Studies of Lokiarchaeota help to elucidate these relationships, but the first universal tree of life was constructed by Carl Woese using ribosomal RNA sequences. There are advantages to using different types of nucleic acid for different types of analyses. What is a specific advantage of using small subunit ribosomal RNA (SSU rRNA) gene sequences for phylogenetic analysis compared with DNA sequences? ▸ View Available Hint(s) SSU rRNA sequences accumulate mutations more rapidly than protein-encoding DNA. SSU rRNA is frequently transferred through horizontal gene transfer, whereas DNA sequences are not. Primers are required in DNA sequence analysis, but not for SSU rRNA sequence analysis. Although PCR products can be visualized with SSU rRNA, this is not the case with other forms of nucleic acids. DNA sequences are too highly conserved to work well for sequence analysis; individual species are…arrow_forwardBased on the information from the following table and the provided phylogenetic tree, what kind of species classification is shown? A B C D E F G H 1 J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L r T Pits) or Tubercles E P P T T T T T P P P P P Р P P O Phenetic Species Concept O Blological Species Concept O Phylogenetic Species Concept O Sympatric Species Concept Blayple (OUTGROUP) beaver Dan, AZ -Twentynine Paime, CA -Harkavilla, UT D-Chilchinbio, NM -Vermilion Cas. AZ 64 -F-Mone Lake, CA -G-Coral Pink Danes, UT H-Pyramid Lake, N -Crescent Dunes, MV Meno Lake CA -K-Olancha CA -Olancha, CA --Winnemucca, NV -El Mirage, CA Lo-Dumont Dunes, CA Form of dorsal ridges M₁ M₁ FFFFFFFFFF M Ma M₂ M₂arrow_forward
- Study the sequences below. Construct a molecular cladogram from the different amino acid sequences given. Assume that the sequences are already compared between species and have been aligned as shown. Species 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 ACT G G C G AT C G 1 2 3 4 5 A C A G ACT G C G C G C T T C G T T C G T C G C A T C G T A C G A C G A C T G C C G T T C G C A T C G T A C G A C T G GAA C G GATC GA C G A T C G C A T C G т A C Garrow_forwardI was given this and made a character matrix from it but I need help creating the most parsimonious phylogenetic tree for it.arrow_forwardFind a current, credible phylogenetic tree representing any group of organisms (your choice)! Draw that tree and on it indicate nodes, synapomorphes, monophyletic, polyphyletic, and paraphyletic groups (make sure the image you choose is complex enough to show all these groups). Below your drawing, in paragraph form, describe the relationships of four of the members on your tree based on how a phylogenetic tree is interpretedarrow_forward
- From the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 O 7 2 3 4 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT E Species Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 5 6 7arrow_forwardGenerate a present (1) or absent (0) code of each character. Afterward, draw the overall phylogenetic tree with the corresponding characters splitting the tree.arrow_forwardDraw a simple phylogenetic tree for two sisters clades with a common ancestor. Each sister clade consists of two taxa. Define the following terms and use to label your diagram: clade, node, branch, common ancestor, and taxon.arrow_forward
- In the table below is a short gene sequence in 4 closely related taxa and an outgroup. Based on comparisons of this DNA sequence, determine the placement of these four taxa in the phylogenetic tree below. Clearly identify the taxon (P, Q, R, or S) that corresponds to each branch tip (1, 2, 3, or 4). Based on your constructed tree, is Species P more closely related to Species Q or Species S? Justify your answer.arrow_forwardSequence data from OTUs are provided in the table below with values provided as (percentage distance x 1000) measurements. Determine the phylogenetic tree from the data in the table below using the UPGMA procedure mentioned in class. Berenstain Bear Berentstain Bear Care Bear Gummi Bear Paddington Bear Care Bear 160 Gummi Bear 150 40 Paddington Bear 80 130 120 Place each OTU in the correct box on the appropriate tree below. Do not label the incorrect tree. Care Bear Gummi Bear Berenstain Bear Paddington Beararrow_forwardMake a phylogenetic treearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Phylogenetic Mysteries: Crash Course Zoology #12; Author: CrashCourse;https://www.youtube.com/watch?v=cVaw7nF72Aw;License: Standard youtube license