From the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 7 2 4 7 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATA AAGACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATA AAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species E ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT Species G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 3 5 6

Q: What is the scientific name of the organism in figure b?

A: Dermatophytosis is a common skin disorder which affects in the places like the nails, hair and…

Q: A. ROOTS Common name: Vetiver (Moras) Scientific name: Morphological character and function(s):…

A: Since you have asked a question with multiple subparts, we will answer only first 3 subparts for…

Q: Species I is diploid (2n=8) with chromosomes AABBCCDD. Related species II is diploid (2n=8) with…

A: Chromosome mutation A chromosomal mutation is a DNA mutation that affects a lengthy stretch of the…

Q: histidine has three pka values: pka=1.7 pk2=6.0, pka 9.1 a- for each pka, find the equilibrium…

A: Consider the acid dissociation reaction at equilibrium; HA⇌H+ + A- here 'HA' is the acid…

Q: Two species of toads are reproductively isolated due to the fact that one species mates in early…

A: Speciation is an evolutionary process in which a lineage is split to create separate species. The…

Q: In aphids, some female clones have wings and others do not. This is an example of: A) Polyphenism B)…

A: Aphids are small, soft-bodied insects that belong to the superfamily Aphidoidea, within the order…

Q: DNA sequences from randomly chosen individuals from the two populations are shown here – A1…

A: Genetic variation is how much the genotype of an organism differs from other organisms. The genotype…

Q: Spirochaetes are free-living, anaerobic bacteria that contain spiral-shaped cells. Nematodes are…

A: Spirochetes These are gram negative bacteria with spiral shape, belonging to the the phylum…

Q: Which of the following statements best explains the importance of sister taxa for understanding the…

A: When two organisms originating from a common ancestor and placed close to each other they form a…

Q: Imagine that Species A and Species B are closely related species. Species A has one hemoglobin gene,…

A: Genes are the functional unit of DNA that is responsible for the production of RNA by the…

Q: 1. Please examine the character matrix below:. Traits | $ * | 7 1 2 3 4 5 6 7

A: Evolution means change. It is the study of origin of life.  A phylogenetic tree is used to depict…

Q: Pseudomonas Алхидейша E. Coli мусорвията Pneumonia Clostridium Botulinum 79% 65% 52%

A: The history of the events by which species of other taxa successively evolve from their common…

Q: Felis catus АTGTTCATAAAСCGGTGACTATТTТСAAСТААТСАСАAAGATATTGGTACTCTTTACСТTТТАТТСGGTGCC Homo…

A: Felis catus :  Phylogeny: This is the phylogenetic tree of the order felidae. As you can see, the…

Q: 8) For each of the genotypes below determine what the phenotype would be. Purple flowers (P) are…

A: Genotype refers to the genetic makeup of an organism, whereas phenotype refers to the traits that…

Q: What are the classification categories from broadest to most specific? What is a species? What are…

A: Classification  Classification is a branch of taxonomy where scientists classify organisms into…

Q: O Biological O Phenetic Phylogenetic Parasympathetic 60 00 100 Blaypis (OUTGROUP) A beaver Dam, AZ…

A: Introduction  A phylogenetic tree is a branching diagram or tree that depicts the relationships that…

Q: In Figure 17-25, which species is most closely related tothe ancestral yeast strain? Why are genes 3…

A: Whole genome duplications are unusual genetic occurrences with deep implications. They double the…

Q: Three species are endemic to a group of islands and are all descended from species 4, a large…

A: Natural selection is an evolutionary process through which natural factors ensure the survival of…

Q: provide the summary/inference (outgroup, etc) of the given tree below.

A: A phylogenetic tree is the diagrammatic representation of evolutionary relationships between…

Q: select the correct options: A) For organisms that diverged  >74 mya, ignore 3rd base positions…

A: Phylogenetic  In biology, phylogenetic is the study evolutionary history and relationships between…

Q: Phylogenetic with branch lengths scaled in genetic distance 0.88 0.88 0.93 0.78 2388-3883 232 2002…

A: Answer.) :-The phylogenetic tree shows the relationship between different samples of Mycobacterium…

Q: https://onlinelibrary.wley.com/do/pdf/10.1:

A: A species are organisms that are capable of reproducing within the their own memebers. However ,…

Q: 4. In the phylogenetic tree shown in figure 1, a) identify the last common an Hint: you can mark or…

A: The above image is of a phylogenetic tree.

Q: Tree 3) Use the data below showing the number of nucleotide differences in the DNA sequences of four…

A: UPGMA or Unweighted Pair Group method with Arithmetic Mean is a process of forming Hierarchical…

Q: What is the format of the above sequence and why?

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…

Q: DNA sequences were analyzed from humans and three other mammals: species X, Y, and Z. Which of these…

A: DNA is stands for deoxyribonucleic acid. DNA is genetic material that is present in each cell of…

Q: mes α S Bl Gy Ay VB ô ß a-Globin gene family on chromosome 16 B-Globin gene family on chromosome 11…

A: false the diagram doesn't explain the gene of alpha globin and beta globin cause the sequence of…

Q: An analysis of an octopus’s DNA determines that the nitrogen base thymine makes up 18 percent of the…

A: DNA has four nitrogen bases -  Adenine  Guanine  Thymine  Cytosine  Chargaff's rule said that DNA…

Q: Species A was recently discovered and its DNA sequence was compared to the DNA of the four…

A: DNA sequencing is the way toward deciding the nucleic acid arrangement – the request for nucleotides…

Q: Below is an aligned DNA sequence dataset for three species and their outgroup. Draw the maximum…

A:

Q: which tree is correct? If both are not correct, pls provide the correct answer.

A: A phylogenetic tree is the diagrammatic representation of evolutionary relationships between…

Q: Sketch the pH speciation diagram for asparagine for the range of 1 < pH < 12, annotate with the…

A: Asparagine is aliphatic, polar uncharged amino acid with carboxamide in its side chain. It is…

Q: Why do related species share homologous traits? Please choose all the FALSE options.   a) Related…

A: Homologous traits are the characteristics that are found in related organisms that share a common…

Q: Please help to creating parsimonious trees For the following DNA sequences determine the most…

A: To create the most parsimonious phylogeny for the given DNA sequences, we need to compare the…

Q: Saola Pseudoryx nghetinhensis (Species) Discuss how you will manage new founders of the saola…

A: Pseudoryx nghetinhensis, commonly known as the saola, is a critically endangered species of bovine…

Q: Swordtails, platyfish and Poecilia species are incapable of interbreeding with each other but…

A: Biological species defines the ability of two organisms to mate and produce offspring successfully…

Q: You have purified cytochrome C from a newly discovered species of bacteria called VCU. When you…

A: Changes in the genetic sequences and amino acid sequences of organisms are the result of random…

Q: hat necessary for two species to be in the same genu

A:

Q: onstruct two types of dichotomous key (indented and bracket type) for these 10 species using the…

A: it is a key used in taxonomy to identify the similar characters.

Q: owing in styles after controlled hand-pollinations in which the two species served as pollen donor…

A: Microsporangia is the male reproductive organ in the plant where the formation of pollen tube takes…

Q: A vestigial trait in species A is a trait that is functional in a closely related species B, but…

A: A vestigial trait is that kind of a trait that has partially or fully lost its functionality over…

Q: For this plant with binomial name Ixora coccinea L., What is the reference to the publication of…

A: Linnaeus named the genus Ixora in 1753; but, historically, it has frequently been merged with the…

Q: Draw the cladogram for "organisms" A-J of the family "Boltidae". Include each of these letters and…

A: Cladogram is a branching diagram which show the cladistic relationship between a number of organisms…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.