From the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 7 2 4 7 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATA AAGACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATA AAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species E ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT Species G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 3 5 6

Q: A. ROOTS Common name: Vetiver (Moras) Scientific name: Morphological character and function(s):…

A: Since you have asked a question with multiple subparts, we will answer only first 3 subparts for…

Q: histidine has three pka values: pka=1.7 pk2=6.0, pka 9.1 a- for each pka, find the equilibrium…

A: Consider the acid dissociation reaction at equilibrium; HA⇌H+ + A- here 'HA' is the acid…

Q: Two species of toads are reproductively isolated due to the fact that one species mates in early…

A: Speciation is an evolutionary process in which a lineage is split to create separate species. The…

Q: From the results of the experiment , explain how we know that the kiwis are more closely related to…

A: Kiwis, emu, moas, and cassowary are all flightless birds belonging to a diverse group called ratite.…

Q: Place each term or phrase in the proper position to identify the item or process being addressed.…

A: Reactions consisting of both oxidation and reduction steps are called redox reactions, where in the…

Q: DNA sequences from randomly chosen individuals from the two populations are shown here – A1…

A: Genetic variation is how much the genotype of an organism differs from other organisms. The genotype…

Q: This phylogenetic tree contains five species (A through E). Which species, or group of species, is…

A: Phylogenetic tree explains the evolutionary pattern among different species.

Q: The study explored population diversity of fungal endophytes present in the mangrove Sonneratia alba…

A: Ecology is the scientific study of how organisms interact with their surroundings. It includes a…

Q: a researcher studying two species (species 1 and species 2) sequences a short stretch of eight…

A: The question includes comparing the sequences of the same gene from two diverse species that had a…

Q: (a) DE GH C B M. A J K (b) DE B G H A J K (c) DE B GH F A K

A: Introduction :  1. Monophyletic taxon : It is defined as the taxon which only includes a group of…

Q: 1. Please examine the character matrix below:. Traits | $ * | 7 1 2 3 4 5 6 7

A: Evolution means change. It is the study of origin of life.  A phylogenetic tree is used to depict…

Q: Character Taxon 4 b + 0 0 о 2 3 + + + + + + + + outgroup D 0 Using this data set, draw your three…

A: I have given the correct answer and accurately, checked it properly, and understand to it.

Q: What is meant by term Allelomorphs?

A: Two British geneticists,  William Bateson, and Edith Rebecca Saunders are credited for discovering…

Q: 10) If you determine that 2 similar organisms distinctly different ways of interacting with other…

A: The organisms are classified as different species based on different concepts. To describe the…

Q: Assume the common ancestor was non-venomous, had non-jointed limbs, antennae, and 10 legs. Assume…

A: A phylogenetic tree is a diagrammatic illustration which determines how taxons/ species are closely…

Q: What are the classification categories from broadest to most specific? What is a species? What are…

A: Classification  Classification is a branch of taxonomy where scientists classify organisms into…

Q: O Biological O Phenetic Phylogenetic Parasympathetic 60 00 100 Blaypis (OUTGROUP) A beaver Dam, AZ…

A: Introduction  A phylogenetic tree is a branching diagram or tree that depicts the relationships that…

Q: (a) Explain how comparing the sequence of bases of genes and the sequence of amino acids of diferent…

A: Evolutionary relationships depicts common ancestry for the populations and the species using certain…

Q: In Figure 17-25, which species is most closely related tothe ancestral yeast strain? Why are genes 3…

A: Whole genome duplications are unusual genetic occurrences with deep implications. They double the…

Q: Three species are endemic to a group of islands and are all descended from species 4, a large…

A: Natural selection is an evolutionary process through which natural factors ensure the survival of…

Q: provide the summary/inference (outgroup, etc) of the given tree below.

A: A phylogenetic tree is the diagrammatic representation of evolutionary relationships between…

Q: Isit true that all known eukaryotes have mitochondria? A. Yes, but some eukaryotes have only one…

A: option- b - No,those that don't contain mitochondria contains chloroplast instead   As per the…

Q: Answer the following question using the provided textbook link:…

A: The discussion about whether Homo habilis should be split into two species or kept as one reflects…

Q: 4. In the phylogenetic tree shown in figure 1, a) identify the last common an Hint: you can mark or…

A: The above image is of a phylogenetic tree.

Q: Write and detail a complete all encompassing definition of a gene. Consider the morphology,…

A: In biology, a gene is the basic physical and functional of heredity, that is made up of DNA. Gene…

Q: Here are the first eighteen positions of DNA sequence alignment, taken from a gene shared by the six…

A: Introduction  A species is an organism's fundamental unit of classification, taxonomic rank, and…

Q: a) What species is considered as the outgroup? (b) What genetic marker is utilized to generate the…

A: (a) Outgroup is a species in the phylogentic tree which is distantly related to other species but…

Q: What is the format of the above sequence and why?

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…

Q: T or F a)Quadrula and Radiatula each have glochidia that are unhooked – this must be a result of…

A: INTRODUCTION Quadrula is a genus of freshwater mussels, also known as pocketbook mussels. They are…

Q: mes α S Bl Gy Ay VB ô ß a-Globin gene family on chromosome 16 B-Globin gene family on chromosome 11…

A: false the diagram doesn't explain the gene of alpha globin and beta globin cause the sequence of…

Q: An analysis of an octopus’s DNA determines that the nitrogen base thymine makes up 18 percent of the…

A: DNA has four nitrogen bases -  Adenine  Guanine  Thymine  Cytosine  Chargaff's rule said that DNA…

Q: Species A was recently discovered and its DNA sequence was compared to the DNA of the four…

A: DNA sequencing is the way toward deciding the nucleic acid arrangement – the request for nucleotides…

Q: Below is an aligned DNA sequence dataset for three species and their outgroup. Draw the maximum…

A:

Q: b) Align the following sequences (don't just retype). i. ATTGCAGGAT ii. ATTGCTGAAT iii. ACGCTGAAT…

A: Multiple sequence alignment (MSA) is aligning more than 2 sequences at a time. The sequences to be…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: The phylogenetic tree and the molecular cladogram are both important tools in molecular biology and…

Q: Please help to creating parsimonious trees For the following DNA sequences determine the most…

A: To create the most parsimonious phylogeny for the given DNA sequences, we need to compare the…

Q: The phylogenetic tree of the OCTN homologs below was generated with the following accession numbers…

A: The smaller SLC22 family has a subgroup of membrane transport proteins called OCTN. Two of the…

Q: Swordtails, platyfish and Poecilia species are incapable of interbreeding with each other but…

A: Biological species defines the ability of two organisms to mate and produce offspring successfully…

Q: You have purified cytochrome C from a newly discovered species of bacteria called VCU. When you…

A: Changes in the genetic sequences and amino acid sequences of organisms are the result of random…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: The phylogenytic tree represent the relationship between different organisms and also gives us idea…

Q: hat necessary for two species to be in the same genu

A:

Q: onstruct two types of dichotomous key (indented and bracket type) for these 10 species using the…

A: it is a key used in taxonomy to identify the similar characters.

Q: owing in styles after controlled hand-pollinations in which the two species served as pollen donor…

A: Microsporangia is the male reproductive organ in the plant where the formation of pollen tube takes…

Q: A vestigial trait in species A is a trait that is functional in a closely related species B, but…

A: A vestigial trait is that kind of a trait that has partially or fully lost its functionality over…

Q: Draw the cladogram for "organisms" A-J of the family "Boltidae". Include each of these letters and…

A: Cladogram is a branching diagram which show the cladistic relationship between a number of organisms…

Q: In the table below, the letters represent amino acids that make up a polypeptide found in all the…

A: According to the question, in the table, the letters represent amino acids that make up a…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.