From the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 7 2 4 7 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATA AAGACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATA AAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species E ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT Species G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 3 5 6

Q: Number of Taxa 3 4568 4 10 Number of possible trees (Write your answer from 5a) 15 105 945 135,135…

A: Branches: If there are n-taxa in an unrooted tree, there are 2n-3 branches

Q: Choose the statement that best describes the outcome of transfecting cells with a plasmid that…

A: A plasmid is an extra chromosomal DNA present within a cell. It is physically separated from the…

Q: Below is the skeletal formula of a molecule typically found in cell membranes. What type of molecule…

A: The plasma membrane of the cell determine the movement of molecules in and out of the cells. The…

Q: Draw a pyramid of numbers using the following data: 480 phytoplankton, 900 zooplankton, 200 C.…

A: PYRAMID OF NUMBER- The number of distinct creatures present at each level of an ecosystem's food…

Q: Determine if anaphase of mitosis contains 2 chromatids or only one chromatid.

A: Mitosis It is a cell division in which the mother cell divides into two progeny with the exact same…

Q: Contain the protein hemoglobin Function in immunity and fighting infections Transport oxygen and…

A: RED BLOOD CELLS- Hemoglobin is a protein found in red blood cells, sometimes referred to as…

Q: What is an "antibody repertoire", and why is it important

A: Introduction An antibody is a protein-based element of the immune system that travels through the…

Q: he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in…

A: Given: The sequence of the alpha-2 globin of the human hemoglobin gene cluster found in chromosome…

Q: What is the difference between a muscle organ, a muscle fiber, a myofibril, and a myofilament?

A: Introduction :  A tissue that aids in the movement of different bodily components is called muscle.…

Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…

A: Removing RNA is one of the crucial processes in plasmid purification, especially after the manual…

Q: Which of the following substances is unlikely to diffuse across the lipid bilayer of a typical cell…

A: The cell membrane is also known as the plasma membrane. It is made up of two phospholipid layers.…

Q: What would be the appropriate and economically wise method for the preservation of a thermophilic…

A: Endospore Some bacteria develop an endospore, which is a tough, inactive, and non-reproductive…

Q: Draw and label a 2n=4 cell going through anaphase I of meiosis.

A: The meiosis involves division of a diploid (2n) mother cell and produce four haploid (n) daughter…

Q: Which of the following specifically explains why glucose uptake into intestinal cells happens in…

A: The most appropriate answer is option C. Na+ ions are always present at higher concentrations…

Q: Vitamin list: Vitamins may be used more than once  Thiamin Folate  Riboflavin Vitamin B12  Niacin…

A:

Q: What evidence did Darwin use to support his theory of evolution by natural selection? Describe…

A: Traits are inherited by offspring from their parents. Changes in these traits over a period of many…

Q: Explain the procedure for 2 hour post prandial testing and oral glucose tolerance testing . Give the…

A: The postprandial glucose blood sugar test can be prepared for in one of two ways. The first…

Q: EVOLUTION LINK The reactions of glycolysis are identical in all organisms-prokaryotes, protists,…

A: Metabolic processes is a type of chemical reaction in which complex molecules are converted to…

Q: A B cat frame-shift no cat no cat cat nonsense cat C % survival 120 100 80 60 40 20 0 42 cat cats…

A: Fig 4: Panel A- Technique: Fluorescence microscopy has been used. All the 4 strains  are grown on in…

Q: A) Identify the structures that would be found in proteins B) identify the structures that…

A: Introduction  Large biomolecules and macromolecules known as proteins are made up of one or more…

Q: What is the major difference in the functions performed by the conventional PCR and real time PCR?…

A: PCR REAL TIME PCR A technique to amplify a segment of DNA , generating millions of copies of a DNA…

Q: Explain the multi hi hypothesis of colorectal adenocarcinoma.  explain step by step  provide the…

A: Introduction- Colorectal cancer (CRC) is one of the commonest cancers and the third leading cause of…

Q: Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had indeed…

A: The annealing temperature is the temperature at which the primers bind to the denatured DNA strands.…

Q: Question 4a-d: H9 IMR90 AT ال ... DMRS Gene Chr10 a. Name one method that could have been used to…

A: DNA methylation is a heritable epigenetic mark that involves DNA methyltransferases covalently…

Q: Cloning of a gene from the rubber tree can be carried out in bacterial cells. However, for the…

A: Cloning: It refers to the process of creating multiple identical copies of gene-sized pieces of DNA.…

Q: Agricultural runoff is a major source of pesticide and excess nutrient pollution. This is a…

A: 1) As agricultural runoff moves, gathers up, and carries away both natural and man-made pollutants,…

Q: Northern blot is an analytical technique commonly performed to study gene expression in experimental…

A: A tissue is defined as a group of cells that possess a similar structure and perform a specific…

Q: 16. Nitrogen bases pair with bases that are O available identical complimentary O opposite

A: Introduction :  The centromere is the region of the chromosome that attaches to a spindle fibre at…

Q: After cloning is carried out to insert a foreign gene into BL21(DE3), you would like to confirm the…

A: The cloning is the technique which is described as the processes used to create an exact genetic…

Q: I'm hoping that I got correct answer on this chart. Can you help me, please?

A: Bacteria are identified using biochemical tests and staining techniques. The best example is the…

Q: Taxon Outgroup A B C D E Character 1 0 0 0 0 0 1 Character 2 0 0 0 0 0 1 Character 3 0 0 0 0 1 1…

A: Introduction  Phylogenetics is the study of links between or among groupings of organisms and their…

Q: A polyhistidine-tag or better known by its trademarked name His-tag is an amino acid motif present…

A: In vectors used to produce recombinant proteins, the DNA sequence defining a string of six to nine…

Q: Read all the parts of this question before answering. Thermogenesis is a metabolic process used to…

A: The generation of ATP depends on the generation of electrochemical gradient in electron transport…

Q: Someone who has been running a race is probably quite hungry at the end of it, while  someone who…

A: Introduction Digestion is the complex process in which complex substances are broken down into…

Q: cule is subjected to complete striction digestion by (1) OKI alone, (2) HindIII alone, and (3) both…

A: Restriction enzymes are a special class of enzyme that cleaves the DNA molecule in particular sites.…

Q: Impairment of intracellular calcium homeostasis in muscle fibers lead to chronic, severe muscle…

A: The sarcoplasmic reticulum(SR) regulates the amount of calcium in muscles. Following an increase in…

Q: Concentration of water samples used to determine urine glucose levels in diamond tetras (Moenkhausia…

A: The body of animals produce many volatile and non-volatile substances. Urine is produced by the…

Q: What significance does the relative size of exons and introns have for the evolution of genes and of…

A: Transcription is a process of synthesis of one stranded mRNA from two stranded DNA . This process…

Q: if telophase I of meiosis contains 2 chromatids or only one chromatid.

A: Meiosis is a cell division seen in sexually reproducing organisms. * Meiosis reduces the number of…

Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…

A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…

Q: Glutamic acid and aspartic acid are both usually negatively charged at a physiological pH of -7.…

A: Introduction  Organic substances known as amino acids have both amino and carboxylic acid functional…

Q: At 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous…

A: Answer : Due to the resonance nature of the purine and pyrimidine bases, nucleic acid strongly…

Q: If the primers you purchased possessed the following information. Number of Guanine: 5 Number of…

A: Melting temperature of primer depends on AT and GC content and length of primer. There are two…

Q: In a saliva of the patient the contents of enzymes is reduced. What cells of secretory portion do…

A: Salivary glands are made up of secretory units also known as acini and ducts. Ducts are highly…

Q: Assume a thylakoid is somehow punctured so that the interior of the thylakoid is no longer separated…

A: Introduction  Chloroplasts and cyanobacteria contain membrane-bound compartments called thylakoids.…

Q: transmission) and ✓transmission, which is transmission through organisms including pesky mosquitoes.…

A: vector is an organism, that do not cause disease itself but it transmits the infection by pathogens…

Q: Differentiate Invitrogen pCR® II-TOPO® Vector from pBR322 Vector.

A: Molecular cloning : Production of genetically identical copies of a cell or its genetic material is…

Q: How many ATPs are there in this triglyceride? Showing NADH and FADH2 calculations and steps

A: Triglycerides broken down into glycerol and three fatty acids containing  12, 16 and 14 carbon atom…

Q: This is affected by things like v enzymes, including collagenase, that are released from the…

A: Bacteria constitue large number of unicelluler organisms. These are mostly belong to kingdom…

Q: Gene cloning is a process in which a gene of interest is identified and made into multiple copies.…

A: Gene cloning is the process that includes the isolation of a specific gene or DNA sequence and then…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.