Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 13PDQ
Assume that a viral DNA molecule is a 50-μm-long circular strand with a uniform 20-Å diameter. If this molecule is contained in a viral head that is a 0.08-μm-diameter sphere, will the DNA molecule fit into the viral head, assuming complete flexibility of the molecule? Justify your answer mathematically.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Please give me correct solution for both questions c and d.
A biological motor used to package double-stranded (ds) DNA into viral capsids is able toexert 50 pN of force.
A. If the active site has a surface area of 10^-17 m2 , to what pressure can the biological motor package dsDNA within the viral capsid before stalling?
B.If the viral capsid has a radius of 30 nm, how much potential energy is stored due to the pressure-confinement of the dsDNA within the capsid?
C. Compare this to thermal energy at room temperature, kBT, where kB=1.38*10^-23 J/K is the Boltzmann constant.
For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the DNA as packaged in nucleosomes with linker histones present.
Chapter 12 Solutions
Concepts of Genetics (12th Edition)
Ch. 12 - In bacteriophages and bacteria, the DNA is almost...Ch. 12 - After salivary gland cells from Drosophila are...Ch. 12 - If a human nucleus is 10 m in diameter, and it...Ch. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - Prob. 2CSCh. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 12 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 12 - Contrast the size of the single chromosome in...Ch. 12 - Describe the structure of giant polytene...
Ch. 12 - What genetic process is occurring in a puff of a...Ch. 12 - During what genetic process are lampbrush...Ch. 12 - Why might we predict that the organization of...Ch. 12 - Describe the sequence of research findings that...Ch. 12 - Describe the molecular composition and arrangement...Ch. 12 - Describe the transitions that occur as nucleosomes...Ch. 12 - Provide a comprehensive definition of...Ch. 12 - Mammals contain a diploid genome consisting of at...Ch. 12 - Assume that a viral DNA molecule is a 50-m-long...Ch. 12 - How many base pairs are in a molecule of phage T2...Ch. 12 - Examples of histone modifications are acetylation...Ch. 12 - Contrast the structure of SINE and LINE DNA...Ch. 12 - Variable number tandem repeats (VNTRs) are...Ch. 12 - It has been shown that infectious agents such as...Ch. 12 - Cancer can be defined as an abnormal proliferation...Ch. 12 - In a study of Drosophila, two normally active...Ch. 12 - Prob. 21ESPCh. 12 - An article entitled Nucleosome Positioning at the...Ch. 12 - Prob. 23ESPCh. 12 - Following is a diagram of the general structure of...Ch. 12 - Microsatellites are currently exploited as markers...Ch. 12 - At the end of the short arm of human chromosome 16...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in µm?arrow_forwardGive Detailed Solution with explanation (no need Handwritten)arrow_forwardThe DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ): a) The length in meters of this chromosome. b) The approximate number of genes in the chromosome (assuming no wasted DNA).arrow_forward
- To answer the prompts below, you will need to draw the chemical structure of the trinucleotide 5' - ACG - 3', labeling the 5' and 3' ends. Opposite this structure, draw the complementary trinucleotide to make a double-stranded DNA molecule. A. What is the complementary trinucleotide sequence from 5' to 3' (enter answer as e.g. CGA)? TCG B. How many non-covalent hydrogen bonds stabilize this structure? 8 C. How many covalent phosphate linkages stabilize this structure? 10 D. Which type of bond takes less energy to break? Phosphate linkage O Non-covalent hydrogen bondsarrow_forwardIf a virus particle contained double-stranded B-DNA of 400,000 base pairs, A. What would be the length (in Angstroms) of the DNA before packing into the virus? B. What would be the radius of the DNA fiber before packing into the virus?arrow_forwardThe Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forward
- The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forwardWhen the helix axis of a closed circular duplex DNA of 2310 bp is constrained to lie in a plane, the DNA has a twist (T) of 207. When released, the DNA takes up its normal twist of 10.5 bp per turn. Indicate the values of the linking number (L), writhing number (W), and twist for both the constrained and unconstrained conformational states of this DNA circle. What is the superhelix density, σ = W/T, of both the constrained and unconstrained DNA circles?arrow_forwardNote that the table provided shows a ligation using a molar ratio of 1:3 vector to insert. Write out the complete recipe for a 5:1 insert: vector ligation reaction, including the volumes of insert and vector you calculated above, and the volumes required for a 20 uL reaction: Ligase buffer Nuclease-free water T4 DNA ligasearrow_forward
- Assume a 5250 base pair, closed circular plasmid with 10 negativesupercoils.(a) Calculate the values of twist (T), writhe (W), and linking number (L) for thisplasmid (use 10.5 base pairs/turn for B-DNA)(b) Your starting plasmid is now A-DNA instead of B-DNA. What is the linkingnumber required to have 10 negative supercoils in this plasmid? (R = 8.3145 J−1 K mol−1; 0 ◦C = 273.15 K; Faraday Constant , F =96485 J V−1 mol−1.)arrow_forwardThe chromosome of the bacterium (prokaryote) Escherichia coli has a size of approximately 4,000 kilobases (kb) [one kilobase = 1,000 bases]. What length of DNA (B form) would be contained in it? How does this length compare to the average size and/or volume of this bacterium?arrow_forwardFor linear 34,000 kb DNA calculate a) contour length; b) the length of DNA as packaged in nucleosomes and c) the length of the DNA in a 30-nm fiber.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY