Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 26ESP
At the end of the short arm of human chromosome 16 (16p), several genes associated with disease are present, including thalassemia and polycystic kidney disease. When that region of chromosome 16 was sequenced, gene-coding regions were found to be very close to the telomere-associated sequences. Could there be a possible link between the location of these genes and the presence of the telomere-associated sequences? What further information concerning the disease genes would be useful in your analysis?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Friedreich ataxia (FRDA) is an autosomal recessive, neurodegenerative disease that causes a lack of voluntary coordination of muscle movements. Affected individuals are homozygous for an unusually large number (expansion) of repeats of a trinucleotide sequence (GAA) in the first intron of the X25 gene. Unaffected individuals typically have between 7 and 38 repeats of the trinucleotide (GAAGAAGAAGAA…). FRDA patients have anywhere from 66 to over 1,700 repeats.
To understand how the GAA trinucleotide expansion leads to FRDA, researchers looked at X25 gene expression by extracting RNA from affected and unaffected patients and doing a northern blot analysis (see the figure below):
In panel “a,” the researchers used a probe to detect X25 mRNA.
In panel “b,” the researchers used a probe on a duplicate of the original blot to detect human GAPDH mRNA (GAPDH is an enzyme involved in glycolysis).
The sample labeled “YR” is mRNA from yeast cells that was used as a control.
Explain…
Huntington’s disease is a hereditary central nervous system disorder characterized by tandem repeats of the sequence 5'-CAG-3' in the gene that encodes a protein called huntingtin. The disease is progressive from generation to generation, meaning that in later generations the number of CAG repeats increases and the age of onset of symptoms decreases. Refer to Figure 21.4 and describe the sort of evidence supporting the generational increase in the number of CAG repeats.
Duchenne muscular dystrophy is caused by a mutation in a gene that comprises 2.5 million base pairs and specifies a protein called dystrophin. However, less than 1% of the gene actually encodes the amino acids in the dystrophin protein. On the basis of what you now know about gene structure and RNA processing in eukaryotic cells, provide a possible explanation for the large size of the dystrophin gene.
Chapter 12 Solutions
Concepts of Genetics (12th Edition)
Ch. 12 - In bacteriophages and bacteria, the DNA is almost...Ch. 12 - After salivary gland cells from Drosophila are...Ch. 12 - If a human nucleus is 10 m in diameter, and it...Ch. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - Prob. 2CSCh. 12 - Roberts syndrome is a rare inherited disorder...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 12 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 12 - Contrast the size of the single chromosome in...Ch. 12 - Describe the structure of giant polytene...
Ch. 12 - What genetic process is occurring in a puff of a...Ch. 12 - During what genetic process are lampbrush...Ch. 12 - Why might we predict that the organization of...Ch. 12 - Describe the sequence of research findings that...Ch. 12 - Describe the molecular composition and arrangement...Ch. 12 - Describe the transitions that occur as nucleosomes...Ch. 12 - Provide a comprehensive definition of...Ch. 12 - Mammals contain a diploid genome consisting of at...Ch. 12 - Assume that a viral DNA molecule is a 50-m-long...Ch. 12 - How many base pairs are in a molecule of phage T2...Ch. 12 - Examples of histone modifications are acetylation...Ch. 12 - Contrast the structure of SINE and LINE DNA...Ch. 12 - Variable number tandem repeats (VNTRs) are...Ch. 12 - It has been shown that infectious agents such as...Ch. 12 - Cancer can be defined as an abnormal proliferation...Ch. 12 - In a study of Drosophila, two normally active...Ch. 12 - Prob. 21ESPCh. 12 - An article entitled Nucleosome Positioning at the...Ch. 12 - Prob. 23ESPCh. 12 - Following is a diagram of the general structure of...Ch. 12 - Microsatellites are currently exploited as markers...Ch. 12 - At the end of the short arm of human chromosome 16...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The D1S80 locus is located on human chromosome 1 and is characterized by a repeating 16 base pair (bp) sequence. Alleles for this locus vary depending on the number of repeats present, thus affecting the size of the locus. The D1S80 locus also contains two conserved sequences, a 32bp sequence at one end and a 113bp sequence at the other end. If the DNA of an individual is targeted for D1S80 amplification, and one of the resulting amplicons is approximately 785bp in size, how many repeats would be present in this D1S80 allele? The amplicon of interest is indicated by a red arrow in the diagram below.arrow_forwardA 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold underlined nucleotides are deleted in a common cystic fibrosis (CF) mutation, removing a phenylalanine amino acid from the CFTR protein. 1 AGAGGGTAAA ATTAAGCACA GTGGAAGAAT TTCATTCTGT TCTCAGTTTT 51 CCTGGATTAT GCCTGGCACC ATTAAAGAAA ATATCATCTT TGGTGTTTCC 101 TATGATGAAT ATAGATACAG AAGCGTCATC AAAGCATGCC AACTAGAAGA 151 GGTAAGAAAC TATGTGAAAA CTTTTTGATT ATGCATATGA ACCCTTCACA 201 CTACCCAAAT PCR primers have been designed to amplify fragments within this sequence: Forward: GGATTATGCCTGGCACCATT Reverse: AGTGTGAAGGGTTCATATGC DNA from a CF patient is tested with a PCR assay using a pair of these primers, and the PCR product is found to be 3 bp shorter than that expected from the sequence shown above. What length PCR products (in bp) would you expect in the mother of the CF patient? A. 95 and 92 B. 149 C. 133 and 130 D. 149 and 146 E. 146arrow_forwardSTR sites are the basis of the FBI Laboratory's Combined DNA Index System (CODIS). One STR site that is used in CODIS is TPOX, named for its location within an intron of the thyroid peroxidase gene located on human chromosome 2. Different versions of the TPOX site are known, due to varying number of repeats of the short sequence "AATG". For TPOX, the number of repeats found on different chromosomes varies from 6 to 13. Hence the "alleles" of this site are called "6", "7", "8", "9", "io", "11", "12" and "13". Any given individual can be homozygous for any one of these eight different alleles or heterozygous for two different alleles of this set. The frequency of any given genotype, however, depends upon the individual frequency of each of these eight alleles in the population. For example, allele "6" occurs at a frequency of less than 5%, allele "11" at a frequency of 20% and allele 8" at a frequency of about 46%. See below for the double stranded DNA sequence of the *11" allele and a…arrow_forward
- With age, somatic cells are thought to accumulate genomic "scars"as a result of the inaccurate repair of double-strand breaks by non homologous end-joining (NHEJ). Estimates based on the frequency of breaks in primary human fibroblasts suggest that by age 70 each human somatic cell may carry some 2000 NHEJ-induced mutations due to inaccurate repair. If these mutations were distributed randomly around the genome, how many genes would you expect to be affected? Would you expect cell function to be compromised? Why or why not? (Assume that 2% of the genome - 1.5% coding and 0.5% regulatory - is crucial information.)arrow_forwardGenes with highly similar sequence are often located adjacent one another in the genome. Gene duplication commonly arises from errors in replication. When the organization of such adjacent genes is in an inverted orientation, this can reduce the expression of other genes that have similar sequence and are located on other chromosomes. Explain the mechanism of how this generally occurs.arrow_forwardTo detect the CAG repeat expansion with a particular gene where 30 repeats in Normal changes to 250 repeats in a certain disease, how can we diagnose the condition. How To identify Y chromosome microdeletion ( which involves the deletion of AZF locus) using conventional karyotyping? If not then why. How will you diagnose a chromosomal translocation event?arrow_forward
- Suppose, you want to detect the CAG repeat expansion within a particular gene (30 repeats in normal changes to 250 repeats in disease) in a certain disease. How will you diagnose this disease condition? Can you identify Y chromosome microdeletion (which involves the deletion of AZF locus) using conventional karyotyping? If not, then why? How will you diagnose a chromosomal translocation event? (Discuss any one of the processes)arrow_forwardAn STR on chromosome 5 is very closely linked to a gene involved in a dominant metabolism disorder (one one copy of the mutation causes the disease). There are four different alleles of the STR (Q, B, S, and L), each with different numbers of GATCTCG repeats. The S allele has 2 repeats, the B allele has 7 repeats, the Q allele has 10 repeats, and the L allele has 5 repeats. Part 1 Lane 1 of the gel shown below indicates the locations of PCR products corresponding to all four STR alleles when run together in one lane. DNA was loaded into the wells at the top of the gel. Move the letter of each allele to its correct position at the left of Lane 1 to indicate where each allele runs on the gel. 0000 Gabriel Andre Lane 1 O Maria Andre Maria Juliana B L Part 2 Andre and Maria are the parents in this family; all others shown on the gel are children. Daughter Juliana is born with the metabolism disorder, but daughter Camila does not have the disorder. Assuming no recombination between the STR…arrow_forwardThere are dozens of common variations of the c-myc gene, which are associated with different types of cancer. Here are 3 variations of part of a sequence of the c-myc gene, located between nucleotides 180 and 201. The original sequence is given to you, as well as the sequences of 3 variations. The mutated nucleotide of each variation is annotated in gray. Use this information (picture) to answer the next two (2) questions 1. Which of the c-myc variations is least likely to cause a change in c-myc function?2. Which variation of c-myc produces a nonsense mutation?arrow_forward
- Genes with highly similar sequence are often located adjacent one another in the genome. Gene duplication commonly arises from errors in replication. When the organization of such adjacent genes is in an inverted orientation, this can reduce the expression of other genes that have similar sequence and are located on other chromosomes. Explain the mechanism of how this generally occurs. Please state the answer in details: what is the mechanism? How it happens? Why this happens? When it happens? And every other necessary information.arrow_forwardIn McCune-Albright syndrome, fibrous connective tissue replaces bone, tan patches (café-au-lait spots) dot the skin, and hormone abnormalities cause early puberty and malfunction of the thyroid, pituitary, and adrenal glands. The phenotype is highly variable, and all patients are somatic mosaics for the mutation, which is in the gene GNAS1. Why is the condition seen only in mosaics?arrow_forwardYou would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License