Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.12, Problem 1CR
Q Explain why incoming DNA recognized by a short RNA molecule expressed from the CRISPR region cannot be completely foreign to the cell.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Explain well. Asap
plz explain with thorough explanation
Describe three (3) ways in which the primary transcript is modified as it is converted to mRNA.
Chapter 11 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 11.1 - Distinguish between a mutation and a mutant.Ch. 11.1 - Distinguish between screening and selection.Ch. 11.1 - Prob. 3MQCh. 11.1 - Write a one-sentence definition of the term...Ch. 11.2 - Do missense mutations occur in genes encoding...Ch. 11.2 - Why do frameshift mutations generally have more...Ch. 11.2 - Prob. 1CRCh. 11.3 - Why are suppressor tRNA mutations not lethal?Ch. 11.3 - Which class of mutation, missense or nonsense, is...Ch. 11.3 - What is the difference between same-site and...
Ch. 11.4 - Prob. 1MQCh. 11.4 - Prob. 2MQCh. 11.4 - Prob. 1CRCh. 11.5 - Which protein, found in virtually all cells,...Ch. 11.5 - Explain the fate of transferred chromosomal DNA if...Ch. 11.5 - Prob. 3MQCh. 11.5 - What are heteroduplex regions of DNA and what...Ch. 11.6 - During transformation a cell usually incorporates...Ch. 11.6 - In genetic transformation, what is meant by the...Ch. 11.6 - QExplain why recipient cells do not successfully...Ch. 11.7 - Prob. 1MQCh. 11.7 - What is the major difference between generalized...Ch. 11.7 - Why is phage conversion considered beneficial to...Ch. 11.7 - QExplain how a generalized transducing particle...Ch. 11.8 - In conjugation, how are donor and recipient cells...Ch. 11.8 - Explain how rolling circle DNA replication allows...Ch. 11.8 - QWhat is a sex pilus and which cell type, F or F+,...Ch. 11.9 - In conjugation involving the F plasmid of...Ch. 11.9 - Prob. 2MQCh. 11.9 - Prob. 3MQCh. 11.9 - QWhat is a merodiploid and how does an F plasmid...Ch. 11.10 - Why is it usually more difficult to select...Ch. 11.10 - Why do penicillins not kill species of Archaea?Ch. 11.10 - Explain one type of conjugation in Archaea and how...Ch. 11.11 - Prob. 1MQCh. 11.11 - What is the significance of the terminal inverted...Ch. 11.11 - How can transposons be used in bacterial genetics?Ch. 11.11 - Prob. 1CRCh. 11.12 - Why is the CRISPR system considered a prokaryotic...Ch. 11.12 - Prob. 2MQCh. 11.12 - QExplain why incoming DNA recognized by a short...Ch. 11 - A constitutive mutant is a strain that...Ch. 11 - Although a large number of mutagenic chemicals are...Ch. 11 - Why is it difficult in a single experiment to...Ch. 11 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Q1: What common mechanism is employed by the guide RNA to find its target DNA sequence? Q2: How many strands of DNA must Cas9 cut to be effective? Q3: Does Cas9 also cause the deletion of DNA from the genome?arrow_forward1b Why aren't ssb proteins necessary in transcription?arrow_forwardDescribe how RBPs can prevent miRNAs from degrading an RNA molecule.arrow_forward
- please help and be precisearrow_forward. Outline an experimental approach to determining the average chain growth rate for transcription in vivo. Chain growth rate is the number of nucleotides polymerized per minute per RNA chain.arrow_forward1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence, transcribe this gene i.e a) write out that sequence of the mRNA you will make from turning on this gene Z b) Label the 5' and 3' ends of the mRNA made 2) Assuming there is a ribosome binding site for the mRNA you just synthesized in the previous question, write out the amino acid sequence of this protein Z that is made (Using the genetic discord Mary provided) The following double stranded DNA sequence provided contains a gene for making proteins Z. The regulatory sequence or switch is indicated by the Red colored sequences. Start of transcription is 10 nucleotide after the switch sequence beginning at the Blue region. Answer the following questions. 3'. TATGACAACGCGTATAATCCAGTCGGTTTGGGGGTAATTGGGCGTCCTACGTCTACAAAGGGTCGTT ААТAGCATTTAGGCGTсTGCCTTTTAТCGTTTATCGAATTтсТТАТTАTTTTAATстCсT...5 5'.ATACTGTTGCGCATATTAGGTCAGCCAAACCCCCATTAACCCGCAGGATGCAGATGTTTCCCAGCAAT…arrow_forward
- Explain well asaparrow_forwardQ. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons. A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correctarrow_forwarda. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Can you be sure?arrow_forward
- List and briefly explain. C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA processing enzymes carry out their duties at the apporpiate time and place?arrow_forwardExplain about Formation of the RNA Polymerase II Transcription Initiation Complex ?arrow_forwardPlease asaparrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License