EBK GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260041255
Author: HARTWELL
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 36P
In the high-throughput DNA sequencing protocol shown in Fig. 11.24:
| a. What is the purpose of adding poly-A to fragments of single-stranded genomic DNA, and why is the poly-A added to the 3′ end of these fragments? |
| b. Why at the end of every synthesis cycle do you need to remove the fluorescent tag on the incorporated |
| c. Why do the incorporated nucleotides have a blocking group, and why does this blocking group need to be removed each cycle? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and
visualized by electron microscopy, two types of structures are seen: RNA:DNA double-stranded
heteroduplexes and single stranded DNA loop structures, as shown in the diagrams below. What do you
think these single stranded DNA loops represent?
(a) Micrograph of DNA-RNA
hybrid
(b) Interpretation of micrograph
Single-stranded
DNA only
Single-stranded DNA
base paired with MRNA
Select one:
а. Exons
b. Introns
c. 5' UTR
d. 3' UTR
e. promoter
A). Briefly describe the function of telomerase. B). How does the structure of telomerase allow it to complete the function you described?
You isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.
Chapter 11 Solutions
EBK GENETICS: FROM GENES TO GENOMES
Ch. 11 - Choose the phrase from the right column that best...Ch. 11 - Would you characterize the pattern of inheritance...Ch. 11 - Would you be more likely to find single nucleotide...Ch. 11 - A recent estimate of the rate of base...Ch. 11 - If you examine Fig. 11.5 closely, you will note...Ch. 11 - Approximately 50 million SNPs have thus far been...Ch. 11 - Mutations at simple sequence repeat SSR loci occur...Ch. 11 - Humans and gorillas last shared a common ancestor...Ch. 11 - In 2015, an international team of scientists...Ch. 11 - Using PCR, you want to amplify an approximately 1...
Ch. 11 - Prob. 11PCh. 11 - The previous problem raises several interesting...Ch. 11 - You want to make a recombinant DNA in which a PCR...Ch. 11 - You sequence a PCR product amplified from a...Ch. 11 - Prob. 15PCh. 11 - The trinucleotide repeat region of the Huntington...Ch. 11 - Sperm samples were taken from two men just...Ch. 11 - Prob. 18PCh. 11 - a. It is possible to perform DNA fingerprinting...Ch. 11 - On July 17, 1918, Tsar Nicholas II; his wife the...Ch. 11 - The figure that follows shows DNA fingerprint...Ch. 11 - Microarrays were used to determine the genotypes...Ch. 11 - A partial sequence of the wild-type HbA allele is...Ch. 11 - a. In Fig. 11.17b, PCR is performed to amplify...Ch. 11 - The following figure shows a partial microarray...Ch. 11 - Scientists were surprised to discover recently...Ch. 11 - The microarray shown in Problem 25 analyzes...Ch. 11 - The figure that follows shows the pedigree of a...Ch. 11 - One of the difficulties faced by human geneticists...Ch. 11 - Now consider a mating between consanguineous...Ch. 11 - The pedigree shown in Fig. 11.22 was crucial to...Ch. 11 - You have identified a SNP marker that in one large...Ch. 11 - The pedigrees indicated here were obtained with...Ch. 11 - Approximately 3 of the population carries a mutant...Ch. 11 - The drug ivacaftor has recently been developed to...Ch. 11 - In the high-throughput DNA sequencing protocol...Ch. 11 - A researcher sequences the whole exome of a...Ch. 11 - As explained in the text, the cause of many...Ch. 11 - Figure 11.26 portrayed the analysis of Miller...Ch. 11 - A research paper published in the summer of 2012...Ch. 11 - Table 11.2 and Fig. 11.27 together portray the...Ch. 11 - The human RefSeq of the entire first exon of a...Ch. 11 - Mutations in the HPRT1 gene in humans result in at...Ch. 11 - Prob. 44P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?arrow_forwardShown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?arrow_forwardFor the experiment shown Fig. 6.30 and 6.31, what is the advantage to use a labeled incoming nucleotide (α-32P-UTP or α-32P-CTP), not labeled reagent 1 itself? Please draw a diagram to help explain your answer by contrasting the RNA polymerase labeled with α-32P-Reagent (Panel A) vs α-32P-UTP (Panel B).arrow_forward
- ( plz give in detail )arrow_forwardMany of the gene products involved in DNA synthesis were initially defined by studying mutant E. coli strains that could not synthesize DNA. (a) The dnaE gene encodes the a subunit of DNA polymerase III. What effect is expected from a mutation in this gene? How could the mutant strain be maintained? (b) The dnaQ gene encodes the e subunit of DNA polymerase. What effect is expected from a mutation in this gene?arrow_forwardDescribe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are present or (b) an excess of primers is present.arrow_forward
- The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.arrow_forwardExplain how DNA polymerase and topoisomerase 2 contribute to replication in E.coli and what is the role of the role of the metal ions in the polymerase activity. B)How does the use of an RNA primer rather than a DNA primer affect the fidelity of DNA replication in E.coli?arrow_forwardThe following diagram shows one-half of a restriction site. (a) Draw the other half. GAC G I C (b) Use heavy arrows (↑1) to identify type II cleavage sites that would yield blunt-ended duplex DNA products. (c) Use light arrows (T1) to identify type II cleavage sites yielding staggered cuts that could be converted directly to recombinant DNA molecules by DNA ligase, with no other enzymes involved. (d) If this were the recognition site for a type I restriction endonu- clease, where would cutting of the duplex occur? (e) If DNA sequences were completely random, how large an inter- val (in kilobase pairs) would you expect between identical copies of this sequence in DNA?arrow_forward
- As shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-stranded; think about these sequences in the forward and reverse directions.) B. What is the most common sequence for a DnaA box? In other words, what is the most common base in the first position, second position, and so on until the ninth position? The most common sequence is called the consensus sequence. C. The E. coli chromosome is about 4.6 million bp long. Based on random chance, is it likely that the consensus sequence for a DnaA box occurs elsewhere in the E. coli chromosome? If so, why aren’t there multiple origins of replication in E. coli?arrow_forwardDuring your experiment you analysed only a few of the recombinant clones for the presence of the highly repeated Aluelements. If you wanted to screen for a single-copy gene, you would need to screen a much larger genomic library. Assuming, that you already know the amino acid sequence of unicorn (a species with a similar physiology to humans) insulin, how would you construct a probe which would enable you to use nucleic acid hybridisation to screen a unicorn genomic DNA library for the insulin gene? Hint: you have access to any molecular biology reagents and equipment you might need, such as vectors, enzymes, and DNA sequencers.arrow_forwardTemplate strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License