Concepts of Genetics (11th Edition)
11th Edition
ISBN: 9780321948915
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 2PDQ
CONCEPT QUESTION Review the Chapter Concepts list on p. 213. Most center around DNA and RNA and their role of serving as the genetic material. Write a short essay that contrasts these molecules, including a comparison of advantages conferred by their structure that each of them has over the other in serving in this role.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
b. What is the difference between the 3' and the 5' ends of a nucleotide chain?
C. Do the chains run the same way?
d. How are the chains connected?
e. Which bases bond to each other?
f. What kinds of bonds hold the chain together?
3. What are the main differences between RNA and DNA?
4. Distinguish between the structure of pyrimidines and purines. Explain why adenine
bonds only to thymine.
5. Name the five nitrogenous bases in the table below, and put an X in the correct column
for each base. Then indicate if the base if found in DNA (D), RNA (R), or both (B)
hp
a) How to transfer biological information in protein synthesis? What is the link between DNA and proteins? What role does RNA play in each? Explain the protein synthesis.
Molecular Biology (Biol-L211)
Dr. Nole
Central Dogma Practice - Processes
The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is
represented by each item in the diagram and clearly address each of the following.
A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA.
B. Label each arrow to indicate which is processing, transcription, replication, and translation.
C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence.
D. Identify the specific location of the place where the start codon and stop codon function most directly.
E. Where does RNA polymerase bind to begin transcription?
F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where
are they found?
G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3',
5', C-terminus, and N-terminus.)
Chapter 10 Solutions
Concepts of Genetics (11th Edition)
Ch. 10 - Would an experiment similar to that performed by...Ch. 10 - In sea urchin DNA, which is double stranded, 17.5...Ch. 10 - German measles results from an infection of the...Ch. 10 - Smallpox, a once highly lethal contagious disease,...Ch. 10 - Prob. 2CSCh. 10 - Prob. 3CSCh. 10 - Prob. 4CSCh. 10 - HOW DO WE KNOW? In this chapter, we first focused...Ch. 10 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 10 - Discuss the reasons proteins were generally...
Ch. 10 - Prob. 4PDQCh. 10 - When Avery and his colleagues had obtained what...Ch. 10 - Why were 32P and 35S chosen for use in the...Ch. 10 - Does the design of the HersheyChase experiment...Ch. 10 - What observations are consistent with the...Ch. 10 - What are the exceptions to the general rule that...Ch. 10 - Draw the chemical structure of the three...Ch. 10 - How are the carbon and nitrogen atoms of the...Ch. 10 - Adenine may also be named 6-amino purine. How...Ch. 10 - Draw the chemical structure of a dinucleotide...Ch. 10 - Describe the various characteristics of the...Ch. 10 - What evidence did Watson and Crick have at their...Ch. 10 - What might Watson and Crick have concluded had...Ch. 10 - How do covalent bonds differ from hydrogen bonds?...Ch. 10 - List three main differences between DNA and RNA.Ch. 10 - What are the three major types of RNA molecules?...Ch. 10 - Prob. 20PDQCh. 10 - What is the physical state of DNA after it is...Ch. 10 - What is the hyperchromic effect? How is it...Ch. 10 - Why is Tm related to base composition?Ch. 10 - What is the chemical basis of molecular...Ch. 10 - What did the WatsonCrick model suggest about the...Ch. 10 - A genetics student was asked to draw the chemical...Ch. 10 - Considering the information in this chapter on B-...Ch. 10 - One of the most common spontaneous lesions that...Ch. 10 - In some organisms, cytosine is methylated at...Ch. 10 - Because of its rapid turnaround time, fluorescent...Ch. 10 - Prob. 31PDQCh. 10 - Prob. 32ESPCh. 10 - Newsdate: March 1, 2030. A unique creature has...Ch. 10 - Prob. 34PDQCh. 10 - During gel electrophoresis, DNA molecules can...Ch. 10 - Electrophoresis is an extremely useful procedure...Ch. 10 - Following is a table (modified from Kropinski,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardGIVE A SHORT ANSWERS TO QUESTIONS GIVEN BELOW Why Phosphate bond is important in DNA or RNA structure?Why G-C forms three hydrogen bonds while A-T forms only two?Briefly explain the importance of poly A tail of mRNA.What is nonsense mutation? Describe with an example.Write the importance of polypeptide bond.Is this possible to create a DNA sequence from an RNA and how?Which gene mutation is much severe and why?What are the possible outcome of Chromosome mutation?Define the domain and motif of protein. Why they are required?arrow_forward
- Based on standard MS- LS3-1: Fish in a cave system in Mexico is missing its eyes, has thin, translucent skin, and is relatively small (7-10 cm in length). Can you describe by model why structural changes to genes (mutations) on chromosomes may affect proteins and may result in beneficial effects to the structure and function of the fish? Can you answer in the following format? 1- Structure How Structure and Function is Affected by Mutations in Blind Fish Eyes Scales Taste Cells Lateral Line 2- Model to explain what causes these changes: Change: ______________ Adapting an Organism to the Dark Cause: ________________ Stop the Growth of Eyes Effect: ___________________ Fish with Heightened Other Senses References: Video: Rare Blind Cave Fish in Mexican Cave System https://www.youtube.com/watch?v=MWdtGuDd8z0 Fact Sheet: Blind Cave Fish https://www.denverzoo.org/animals/blind-cave-fish Information: Mexican Tetra…arrow_forwardUsing sickle-cell anemia as an example, describe what is meant by a molecular or genetic disease. What are the similarities and dissimilarities between this type of a disorder and a disease caused by an invading microorganism?arrow_forwardGiven the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro inarrow_forward
- Explain how there are going to be 6 nucleotides needed?arrow_forward28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.arrow_forwardOrnithine is structurally similar to lysine except ornithine’s side chain is one methylene group shorter than that of lysine. Attempts to chemically synthesize and isolate ornithinyl-tRNA proved unsuccessful. Propose a mechanistic explanation. (Hint: Six-membered rings are more stable than sevenmembered rings.)arrow_forward
- Ribonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains it. a. Ribonuclease requires two active site histidines to be active but the nucleobase of DNA will form hydrogen bonds with these histidines and block their acid-base catalysis. b. DNAs have thymidine that is more stable than the uracil in RNAs c. DNAs are double-stranded and the nucleobases are protected while RNAs are single stranded d. DNAs does not have hydroxyl group at 2' position of the sugar ring to support the catalysisarrow_forwardConsider the expression “central dogma,” which refers to the flow of genetic information from DNA to RNA to protein. is the word “dogma” appropriate in this context?arrow_forwardEvaluate the following statements. Which one statement is false? a. The active form of prokaryotic RNA polymerase is a haloenzyme. b. Anti-codons are a nucleotide triplet in transfer RNA that are complementary and antiparallel to the codons of messenger RNA c. During translation, the terminal carboxyl group of an existing peptide will form a peptide bond with the next amino acid in sequence. d. The amino acid R-group is necessary for the formation of tertiary and quaternary structures through covalent bonds, ionic bonds, hydrogen bonds, and hydrophobic interactions. e. The sigma factors of prokaryotes are responsible for binding a DNA promotor sequence so translation can begin. f. The terminal carboxyl and terminal amino groups of amino acids within a peptide are necessary for the formation of secondary structures through hydrogen bonds. g. A restriction enzyme can target supercoiled, relaxed, or linearized plasmid DNA. h.…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license