Concepts of Genetics (11th Edition)
11th Edition
ISBN: 9780321948915
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 28PDQ
One of the most common spontaneous lesions that occurs in DNA under physiological conditions is the hydrolysis of the amino group of cytosine, converting the cytosine to uracil. What would be the effect on DNA structure of a uracil group replacing cytosine?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Describe the functions of the following proteins during DNA breaks and repair:
(i)
Ku70
(ii)
Uracil DNA glycosylase
Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA:
3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'
Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________
Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47:
mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-
polypeptide chain: ________--________--________--________--________--________--________--________
Chapter 10 Solutions
Concepts of Genetics (11th Edition)
Ch. 10 - Would an experiment similar to that performed by...Ch. 10 - In sea urchin DNA, which is double stranded, 17.5...Ch. 10 - German measles results from an infection of the...Ch. 10 - Smallpox, a once highly lethal contagious disease,...Ch. 10 - Prob. 2CSCh. 10 - Prob. 3CSCh. 10 - Prob. 4CSCh. 10 - HOW DO WE KNOW? In this chapter, we first focused...Ch. 10 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 10 - Discuss the reasons proteins were generally...
Ch. 10 - Prob. 4PDQCh. 10 - When Avery and his colleagues had obtained what...Ch. 10 - Why were 32P and 35S chosen for use in the...Ch. 10 - Does the design of the HersheyChase experiment...Ch. 10 - What observations are consistent with the...Ch. 10 - What are the exceptions to the general rule that...Ch. 10 - Draw the chemical structure of the three...Ch. 10 - How are the carbon and nitrogen atoms of the...Ch. 10 - Adenine may also be named 6-amino purine. How...Ch. 10 - Draw the chemical structure of a dinucleotide...Ch. 10 - Describe the various characteristics of the...Ch. 10 - What evidence did Watson and Crick have at their...Ch. 10 - What might Watson and Crick have concluded had...Ch. 10 - How do covalent bonds differ from hydrogen bonds?...Ch. 10 - List three main differences between DNA and RNA.Ch. 10 - What are the three major types of RNA molecules?...Ch. 10 - Prob. 20PDQCh. 10 - What is the physical state of DNA after it is...Ch. 10 - What is the hyperchromic effect? How is it...Ch. 10 - Why is Tm related to base composition?Ch. 10 - What is the chemical basis of molecular...Ch. 10 - What did the WatsonCrick model suggest about the...Ch. 10 - A genetics student was asked to draw the chemical...Ch. 10 - Considering the information in this chapter on B-...Ch. 10 - One of the most common spontaneous lesions that...Ch. 10 - In some organisms, cytosine is methylated at...Ch. 10 - Because of its rapid turnaround time, fluorescent...Ch. 10 - Prob. 31PDQCh. 10 - Prob. 32ESPCh. 10 - Newsdate: March 1, 2030. A unique creature has...Ch. 10 - Prob. 34PDQCh. 10 - During gel electrophoresis, DNA molecules can...Ch. 10 - Electrophoresis is an extremely useful procedure...Ch. 10 - Following is a table (modified from Kropinski,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forwardConsider a three-base sequence in the template of DNA: 5' . . . 123 . . .3', in which 1, 2, and 3 refer to the relative positions of deoxyribonucleotides.Comment on the probable effect on the resulting protein if the following point mutations (one-base substitutions) occurred.(a) changing one purine for another in position 1(b) changing one pyrimidine for another in position 2(c) changing a purine to a pyrimidine in position 2(d) changing one purine for another in position 3arrow_forwardIn E. coli, all newly synthesized DNA appears to be fragmented (an observation that could be interpreted to mean that the leading strand as well as the lagging strand is synthesized discontinuously). However, in E. coli mutants that are defective in uracil–DNA glycosylase, only about half the newly synthesized DNA is fragmented. Explain.arrow_forward
- DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?arrow_forwardWhat is meant by the description "antiparellel" regarding the two strands that make up DNA?arrow_forwardWhat would the effect be if there was a substitution of one nucleotide for another?arrow_forward
- How important and useful to the cell is the ability of the DNA to assume various forms? Why are these various forms necessary?arrow_forwardRibonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains it. a. Ribonuclease requires two active site histidines to be active but the nucleobase of DNA will form hydrogen bonds with these histidines and block their acid-base catalysis. b. DNAs have thymidine that is more stable than the uracil in RNAs c. DNAs are double-stranded and the nucleobases are protected while RNAs are single stranded d. DNAs does not have hydroxyl group at 2' position of the sugar ring to support the catalysisarrow_forwardGiven the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro inarrow_forward
- If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?arrow_forwardIn the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forwardWhy is the α-helix so prevalent?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license