Concepts of Genetics (11th Edition)
11th Edition
ISBN: 9780321948915
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 3PDQ
Discuss the reasons proteins were generally favored over DNA as the genetic material before 1940. What was the role of the tetra-
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Erwin Chargaff conducted several studies on the base composition of DNA. The data in Table
1 shows the molar properties of bases in the nucleic acid from six different living organisms.
Nucleic acid
Yeast
Paracentrotus
lividus
Herring
Rat
Human
Species Z
(i)
(ii)
(iii)
Adenine
31.3
32.8
27.8
28.6
30.7
30.9
Table 1
Percentage (%)
Thymine
32.9
32.1
27.5
28.4
31.2
29.4
Guanine
18.7
17.7
22.2
21.4
19.3
?
Cytosine
17.1
18.4
22.6
21.5
18.8
?
A+G
G+C
1.79
1.85
1.23
1.33
1.62
?
What are the percentage of Guanine and Cytosine in Species Z?
Which organism has the higher melting point for its DNA structure compared to Species
7.?
Explain why DNA in the presence of salt will have a higher melting temperature (Tm).
a) Explain the effect of the guanine:cytosine ratio on melting temperature of DNA.
b) The Hershey-Chase experiment proved that DNA is the genetic material and not protein. Explain in detatil how this experiment was conducted.
Name the bases in the pentanucleotide with the sequence G-A-U-C-A. Does this come from RNA or DNA? Explain.
Chapter 10 Solutions
Concepts of Genetics (11th Edition)
Ch. 10 - Would an experiment similar to that performed by...Ch. 10 - In sea urchin DNA, which is double stranded, 17.5...Ch. 10 - German measles results from an infection of the...Ch. 10 - Smallpox, a once highly lethal contagious disease,...Ch. 10 - Prob. 2CSCh. 10 - Prob. 3CSCh. 10 - Prob. 4CSCh. 10 - HOW DO WE KNOW? In this chapter, we first focused...Ch. 10 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 10 - Discuss the reasons proteins were generally...
Ch. 10 - Prob. 4PDQCh. 10 - When Avery and his colleagues had obtained what...Ch. 10 - Why were 32P and 35S chosen for use in the...Ch. 10 - Does the design of the HersheyChase experiment...Ch. 10 - What observations are consistent with the...Ch. 10 - What are the exceptions to the general rule that...Ch. 10 - Draw the chemical structure of the three...Ch. 10 - How are the carbon and nitrogen atoms of the...Ch. 10 - Adenine may also be named 6-amino purine. How...Ch. 10 - Draw the chemical structure of a dinucleotide...Ch. 10 - Describe the various characteristics of the...Ch. 10 - What evidence did Watson and Crick have at their...Ch. 10 - What might Watson and Crick have concluded had...Ch. 10 - How do covalent bonds differ from hydrogen bonds?...Ch. 10 - List three main differences between DNA and RNA.Ch. 10 - What are the three major types of RNA molecules?...Ch. 10 - Prob. 20PDQCh. 10 - What is the physical state of DNA after it is...Ch. 10 - What is the hyperchromic effect? How is it...Ch. 10 - Why is Tm related to base composition?Ch. 10 - What is the chemical basis of molecular...Ch. 10 - What did the WatsonCrick model suggest about the...Ch. 10 - A genetics student was asked to draw the chemical...Ch. 10 - Considering the information in this chapter on B-...Ch. 10 - One of the most common spontaneous lesions that...Ch. 10 - In some organisms, cytosine is methylated at...Ch. 10 - Because of its rapid turnaround time, fluorescent...Ch. 10 - Prob. 31PDQCh. 10 - Prob. 32ESPCh. 10 - Newsdate: March 1, 2030. A unique creature has...Ch. 10 - Prob. 34PDQCh. 10 - During gel electrophoresis, DNA molecules can...Ch. 10 - Electrophoresis is an extremely useful procedure...Ch. 10 - Following is a table (modified from Kropinski,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How many kilobases of the DNA strand below will code for the protein product?arrow_forwardChemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?arrow_forwardWhich of the following is true regarding the 5’ vs. the 3’ end of a strand of DNA? a) only double-stranded DNA can have a 5' and a 3' end b) 5' and 3' are designations of the carbon in the deoxyribose of a nucleotide that is not bound to another deoxyribose or phosphate group c) 5' and 3' are designations of the DNA base that is unbound to another base d) The 5' end of DNA is always considered the start of the gene and the 3' end is considered the endarrow_forward
- The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?arrow_forwardCan you please answer these questions? I don’t know the right answers.arrow_forwardWhich of the following does NOT describe DNA as it occurs in Eukaryotic cells. CHOOSE ALL THAT APPLY: 1. nitrogenous bases of opposite strands are paired through covalent bonds 2. base pairs are stacked 3.4 A (0.34 nm) apart 3. the two strands of one double helix are complementary 4. two long polynucleotide chains 5. there are 20 base pairs per each turn of a double helix 6. adenine pairs with thymine of the neighboring nucleotide in a single DNA strand 7. bases face outside of the double helix 8. consecutive nucleotides of a single DNA strand are linked by hydrogen bonds 9. here are A-T and G-C pairs in DNA double helix 10. sugar-phosphate backbone of a single DNA strand is formed by linking deoxyribose units and phosphate groups through phosphodiester bonds 11. the two strands of one helix are antiparallel 12.double helix 13. the larger major groove alternates with the smaller minor groove along the length of the double stranded DNA I tried 2,3,4,9,10,11,12,13 together and got it…arrow_forward
- Adenine Cytosine Guaninearrow_forwardWhile trying to determine the structure of DNA, Watson and Crick at one point proposed that like bases are bonded to like bases. For example, thymine would be bonded to thymine, cytosine would be bonded to cytosine, and so on. Explain why this proposed model would not fit based on what was discovered to be true about DNA.arrow_forwardYou have a sample of genetic material. The nitrogenous base content is 29% guanine. a) If the sample is DNA, what are the amounts of the other bases? Explain your thought process b) Why can you not determine the amounts of the other bases if the sample is RNA? Explain your answer c) How did Watson and Crick make use the relationships between base pairs as they constructed the model for DNA?arrow_forward
- Which one of these facts would NOT be needed in order to determine the correct base sequence from the image of DNA in the question above? Adenine and guanine are purines with a two-ring chemical structure. Cytosine and thymine are pyrimidines with a one-ring chemical structure. Adenine pairs only with thymine using two hydrogen-bonds. Cytosine pairs only with guanine using three hydrogen-bonds. All of the facts above are needed.arrow_forwardThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forwardDNA is a nucleic acid that consists of thousands of smaller, repeating units callednucleotides. What function do nucleic acids serve besides storing geneticinformation?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License