Which of these two sequences has a higher melting temperature (TM)? Explain the molecular basis for this difference. 1. CATTAAGTGAT 2. GCTTAAGGGCT
Q: Autosomal Recessive Disorder: Cystic Fibrosis 2. Cystic fibrosis is lethal autosomal recessive…
A: An autosomal recessive trait is a genetic condition or characteristic that is expressed when an…
Q: 1. Ethanol is a mild toxin to most living organisms and is broken down by the enzyme alcohol…
A: Nutrient absorption is a crucial process for plant growth and development. Plants require various…
Q: What is the Complimentary DNA Strand to CGTCAGCAGACGAAAGGGCTTGCGGCGCGC. What is the content of CG in…
A: To find the complementary DNA (cDNA) strand, we need to identify the base pairs for each nucleotide…
Q: Elevated levels of cortisol have been shown to reduce areas of the hippocampus in the brain…
A: INTEODUCTION: Cortisol is a hormone secreted by adrenal gland from its cortex portion. Cortisol is…
Q: A person who has an infection that causes their whole body to feel aches is suffering from a…
A: Because widespread symptoms like body aches, weariness, fever, and a general malaise are typical of…
Q: Suitable hypothesis that will predict answers for the following: A) what is the rate of germinating…
A: An explanation or claim that is put forth as the foundation for more research or testing is called a…
Q: Give only typing answer with explanation and conclusion A mothers father who is not bald marries a…
A: The likelihood of inheriting certain traits, such as baldness, can be a subject of curiosity when…
Q: Sophie's allele
A: DNA profiling, also known as genetic fingerprinting or DNA typing, is a forensic technique used to…
Q: How will you measure the the zones of inhibition for exercise 6-7, 6-8 and the Kirby-Bauer meth By…
A: How will you measure the the zones of inhibition for exercise 6-7, 6-8 and the Kirby-Bauer method By…
Q: Help me solving this question. Explain please
A: A test cross is a breeding technique used in genetics to determine the genotype of an individual…
Q: 1. What is a standard plate count? Is it a good method for estimating microbial population size?
A: A standard plate count (SPC) is a microbiological method that estimates the number of viable…
Q: Can you say that the microbial composition changes over time in each of the body locations
A: In hot summer months, the higher ambient temperature would likely accelerate the decomposition…
Q: For the guy micro biome Find a recent (2015 or newer) primary research article that investigates…
A: Gut microbiome are the collection of all microbes, they are like bacteria, virus and also their…
Q: 1. Identify the type of tissue present for the following organs. Then look for a disease or disorder…
A: Human esophagus is also called food pipe. Food passes through this pipe into the stomach. Human…
Q: Human muscle cells use lactic acid fermentation to produce ATP without O2. regenerate…
A: Human muscle cells use lactic acid fermentation to:produce ATP without O2.During intense physical…
Q: What is the benefit of the interior rotation of frog gastrulation? a. Formation of the archenteron…
A: Gastrulation is the stage where three germ layers are formed in many animals. It occurs after the…
Q: A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species…
A: Trinitrotoluene (TNT), a solid organic nitrogen chemical that is mostly utilised as an explosive and…
Q: Latency and sequelae are two example of infections. O Primary O Chronic
A: Both latency and sequelae are characteristic of chronic infections, where the infection persists…
Q: Humans convert approximately ______ of the energy stored in food to useful work. 99.9% 34%…
A: Energy conversion refers to the process of transforming energy from one form to another. This…
Q: Answer the following questions to check your understanding of the reading. 5. How many genes account…
A: Single nucleotide polymorphisms (SNPs) in GWAS are essential for understanding the genetic…
Q: Solvent Je ed After Ten Minutes llow one are attracted to the developing solution.
A: Thin Layer chromatography is depicted in the figure. This type of chromatography is used for the…
Q: Using the date in the photo of the two syringes below, answer these six questions: QUESTIONS 1.…
A: The given data and the graph represent the relationship with the photosynthesis process. The…
Q: Artifactual hyperkalemia: a.Sample hemolysis b.Sample hemolysis, thrombocytosis c.Sample…
A: Artifactual hyperkalemia:Hyperkalemia is a condition where the potassium concentration in the serum…
Q: Give only typing answer with explanation and conclusion I performed an RBC count on squares 1,…
A: Finding the average number of cells per square and multiplying it by the total number of squares…
Q: 1. What fermentation tube is the control tube in this experiment? 2. What two fermentation tubes can…
A: Yeast fermentation is a metabolic process that occurs in yeast cells, wherein they convert sugars…
Q: 3. Yeast is an important commercial organism because engineers are able to use its capabilities of…
A: Yeast is eukaryotic unicellular fungus which is also known as Saccharomyces cerevisiae. It come in…
Q: bacteria are killed by an antibiotic, the antibiotic is ["Bactericidal" OR "Bacteriostatic"]…
A: Antibiotics are certain chemicals that are produced by microorganisms to kill or curb the growth of…
Q: Humans are both autotrophs and producers. heterotrophs and consumers. heterotrophs…
A: The numerous means by which organisms receive the fuel and nutrients necessary for their existence,…
Q: Why are there two sexes? Why don’t we often see three sexes?
A: The reproductive system and biological distinctions between males and females provide the foundation…
Q: You are an extraterrestrial geneticist working at Area 51 to sequence the genome of a recently-…
A: The production of polypeptide chain or protein (made up of amino acids) from the mRNA is known as…
Q: Which of the following types of vaccines have the greatest efficacy? (provides the best results). A)…
A: Getting vaccinated is an easy, risk-free, and efficient strategy to guard against dangerous diseases…
Q: An agriculture extension agent is preparing pamphlets on preventing the spread of disease. In the…
A: Disinfectants are antimicrobial substances that are applied to the surface of non-living objects to…
Q: The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide…
A: Transcription is the process of converting a portion of DNA into RNA. RNA polymerase is the enzyme…
Q: Most medically useful antibiotics interfere with either peptidogly¬can synthesis or ribosome…
A: Antibiotics need to selectively target bacterial structures or processes while sparing human cells…
Q: 4. What are the two experimental variables in this experimental design? 5. What gas is collecting in…
A: The effect of temperature and food source on yeast fermentation is examined in this experimental…
Q: Using the given pedigree chart, suppose individuals III-1 and III-2 are expecting their sixth…
A: Sickle cell anemia is autosomal recessive disorder. Hence 2 mutant genes are needed to form the…
Q: How can you analyze your potential internal and external environment through an environmental scan…
A: To conduct an environmental scan for Kibbles and Bits using secondary data, you can follow these two…
Q: (ii) A regulatory protein binds at each of the activator, insulator, and silencer. 4. [Select] 5.…
A: In every cell of an organism, the complete set of genetic information, or genome, is present.…
Q: Identify and explain two examples of diffusion you have experienced. Provide specific details in…
A: The net passive transportation of molecules from higher concentration areas to the lower…
Q: The experiments were conducted in 1952 that helped to confirm that DNA is genetic material. The…
A: A polymer made of two polynucleotide chains which wrap around one another to create a double helix…
Q: A 53-year-old woman calls the office reporting that she noticed last evening that an area in her…
A: Follow office policy to ensure the correct course of activity whereas reacting to a call from a…
Q: Predict the most likely outcome if proteins did not have "R" groups. Without "R" groups, proteins…
A: The most likely outcome if proteins did not have "R" groups would be that proteins would not be able…
Q: The yellow coat color allele of mice (AY) is dominant for coat color over the wild type agouti…
A: In this type of questions it is important to perform cross and eliminate the lethal first because it…
Q: 1 ATP V Δ2 1 A 3 Name the type of membrane transport shown in the picture above (number 1-4). For…
A: Intermembrane transport refers to the movement of substances across the membranes that separate…
Q: Select all that apply: Triclosan affects the structure of ODNA Proteins Cell walls O Cell membranes
A: Triclosan is a broad-spectrum antimicrobial agent that is commonly used in personal care products,…
Q: Give typing answer with explanation and conclusion Development of the Nervous System 3. The neural…
A: It is the network of cells and nerves, which acts as messengers between the brain and spinal cord…
Q: Please answer asap and type your answer and do not copy from anywhere please 1. In order to ‘drive’…
A: It's critical to comprehend the many ways and elements at play while talking about spore staining…
Q: https://m.youtube.com/watch?v=3KL7lcWMkz0&pp=ygUbMjEuIHRoZSB0dXNrZWdlZSBleHBlcmltZW50 Where and…
A: Tuskeegee experimental study was a kind of unethical study performed in the past. The study was…
Q: 3. You are planning to build a greenhouse for the school. This graph shows the effect of temperature…
A: 35°C shows better CO2 absorption as it reaches the saturation at much higher level of CO2 compared…
Q: Match the types of bonds to their definitions. lonic Bond Polar Covalent Bond Nonpolar Covalent Bond…
A: The ability of an atom to draw electrons into a chemical connection is known as electronegativity.…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Which of these two sequences has a higher melting temperature (TM)? Explain the molecular basis for this difference.
1. CATTAAGTGAT
2. GCTTAAGGGCT
Step by step
Solved in 3 steps
- Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…The amino acid sequences of a yeast protein and a human protein having the same function are found to be 60% identical. However, the corresponding DNA sequences are only 45% identical. Account for this differing degree of identity.
- A portion of gene sequence was expressed to its protein product: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3'-ТАССТТААСCGTАCСАААTGGGCACTACCA-5' 1. Determine the sequence of peptide product from the sequence shown 2. Calculate the pl 3. If transition happended at one of the bases colored red, determine the consequent sequence of the protein product. If this is a part of a larger protein, how would it affect the function of this protein product if it is an enzyme?11) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the table below for assistance. U C A G บบน UUC UUA UUG CUU CUC CUA CUG U Phe GUUT GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or Start Val Ceweg 232 www... UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG C GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG A AAU AAC AAA AAG UAU U UAC C UAA Stop UGA Stop A UAG Stop UGG Trp G Tyr GAA GAG His Gin Asn Lys GAU GAC Asp G c] Glu UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Arg Ser Arg Gly U C A G U C A G U C A G by Calin me press A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function…28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?X The phosphates that make up the phosphodiester bonds in DNA have pKa≈ 2. The genome of the blue crab is 800 million-base-pairs long. What is its total charge on the blue crab genome in aqueous buffer solution when the pH is equal to 2.25?
- a. Explain how the sea urchin and salmon data demonstrate both of Chargaff’s rules b. How significant is the Chargaff’s rule in the creation of the DNA model? c. You are a molecular biologist and you observed that the amount of the combined purinenitrogenous base in the DNA of an unknown species of freshwater fish in your vicinity is equivalentto 68%, and you determined that it possesses 16% Thymine in its RNA. How much Adenine,Guanine and Cytosine is present in the DNA of this freshwater fish? Explain how you arrived at youranswer.A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?43 For the amino acid sequence shown, could more than one sequence of bases in MESSENGER RNA encode this peptide? MET-PRO-LYS-GLY SER Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a YES NO Unanswered Save 44 A mutation that changes the amino acid sequence in a protein sometimes increases the fitness of the individual. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a TRUE FALSE