b. 600 bp С. 2000 bp d. 3000 bp e.)6000 bp 2. The telomeric sequence in a species is (5'-AACGGT-3')n repeats. You design a FISH experiment with the probe 5'-AACGGTAACGGTAACGGTAACGGT-3'. Which of the following illustrates the expected image of a metacentric chromosome (the dark region indicates fluorescence)? a. b. С. X X X е. d. 3. Which of the following marks is associated with heterochromatin?

b. 600 bp С. 2000 bp d. 3000 bp e.)6000 bp 2. The telomeric sequence in a species is (5'-AACGGT-3')n repeats. You design a FISH experiment with the probe 5'-AACGGTAACGGTAACGGTAACGGT-3'. Which of the following illustrates the expected image of a metacentric chromosome (the dark region indicates fluorescence)? a. b. С. X X X е. d. 3. Which of the following marks is associated with heterochromatin?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630
Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?
Explain how DNA probes with different fluorescence emissionwavelengths can be used in a single FISH experiment to map thelocations of two or more genes. This method is called chromosomepainting. Explain why this is an appropriate term.
You are sequencing the genome of newly discovered bacterium, and know nothing of its sequence except that it is one single circular chromosome about 6,000,000 bp long. Your raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3' 5'-GTTACGCTTAGATAACACAAG-3' Based on this data, give the sequence of one sequence read: Based on this data, give the sequence of one sequence contig: C. So far, the researchers have assembled all the data they have into three sequence contigs. Have they sequenced the whole genome? Briefly explain, in one or two sentences.
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’
The axial ratio is a term used to describe a rod-shaped molecule using the ratio of its length to its diameter. Given that the standard conformation of DNA in a physiological solution has a diameter of 2.37 nm, what is the axial ratio of the longest chromosome of Drosophila melanogaster DNA, which is 21000 µm long? Please record your answer in scientific notation. axial ratio: x10
The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…
What size DNA fragment would be released after very mild digestion of chromatin with micrococcal nuclease? (This would represent a single cut per nucleosome.) 30 bp O 165 bp 146 bp 200 bp
Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; together with one of the 4 deoxynucleotides (DATP, DGTP, DCTP and DTTP), one for each lane, in each vial. O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (DATP, DGTP, dCTP and dTTP), to all of the reaction vials O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane, together with all of the 4 deoxynucleotides (dATP, DGTP, dCTP and ATTP) in each vial
In hybridizing microarrays, we use a solution that contains {3X SSC, 0.5% SDS, 5ug/ml salmon sperm DNA, 5% glycerol}. Describe how to make 100ul of this solution using stocks of 20X SSC, 10% SDS, and 10 mg/ml salmon sperm DNA, sheared, in water. Note that Molecular Biology Grade H2O must be used in making up this solution.