What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’

Q: UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?

A: The set of "rules" that a cell uses to decipher the nucleotide sequence contained in an mRNA…

Q: What is the codon for the MRNA? DNA coding strand bases messenger RNA non-coding strand

A: There are four bases Adenine(A), Guanine(G), Cytosine(C), Uracil(C).

Q: How many amino acids are in KMT2D peptide sequence?

A: Introduction  Organic substances known as amino acids have both functional groups for amino and…

Q: 19. Endorphins are polypeptides that reduce pain. What is the amino acid order for the following…

A: The body produces endorphins, which are neurotransmitters that can provide sensations of pleasure or…

Q: What is the sequence of amino acids for if the DNA sequence given is (remember direction RNA…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: What amino acid sequence is coded by the following mRNA base sequence?

A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: Label the N-terminal and the C-terminal in the above peptide.

A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'

A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…

Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: The nucleotide is adenine adenosine adenosine monophosphate cytidine prion

A: A nucleotide is the basic building block of nucleic acids like RNA and DNA. The nucleic acids act as…

Q: CH3 15 HN 9, *0-P-OCH2 5' 1' 4" 3' 2' Он LO

A: A nucleotide is an organic compound that acts as a polymer for the synthesis of DNA/RNA and it is…

Q: Translate the following mRNA codons: 5' AAG UGG CAU ACG - 3' Write your answer in order (first codon…

A: Translation in molecular biology is the process by which the RNA of the cell is read and comment…

Q: Write the complementary sequence for TCGAAC. Write the new sequence in the standard 5' → 3'…

A: DNA structure, base-pairing rules, and the 5' → 3' notation.1. DNA Structure:DNA (Deoxyribonucleic…

Q: What is the Amino Acid Sequence of 3'-AUG GUA CUC UUA ACA CCA GUG GAA AAA-5'

A: Proteins are polymers made of amino acids. The cellular process by which proteins are synthesized by…

Q: t RNA is  3`UAC 5` so m RNA  -5` AUG 3` but why mRNA can not be the 5'GUG'3 based on wobble…

A: Wobble base pair It is a pairing of two nucleotides in RNA molecules that does not follow the rules…

Q: For the peptide that is pictured, I am supposed to count how many amino acids there are.

A: Polypeptide chains have amino acids that are linked together via peptide linkages. The sequence of…

Q: Titrated the polypeptide with DTNB. The absorbance of the obtained yellow color was 0.16. 1.…

A: "Since you have asked multiple questions, we will solve the first two question for you. If you want…

Q: A nontemplate strand of bacterial DNA has the base sequence 5'-ATGATACTAAGGCCC-3' Determine the…

A: The central dogma of molecular biology describes the flow of information in biological systems.  It…

Q: How do I determine an amino acid sequence from RNA? I know you start at AUG which is methionine…

A: To determine an amino acid sequence from RNA, the translation machinery makes use of the genetic…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: What will be the next amino acid added to the growing polypeptide chain?

A: mRNA contains codons and tRNA contains anticodon. Codons and anticodons are complementary to each…

Q: what is  protein His-PPX  means

A: PROTEIN HIS - PPX  :- the  Escherichia coli Ppx protein is an exopolyphosphatase that degrades…

Q: -rich DNA is denser than -rich DNA because has a higher molecular mass than while occupying the same…

A: DNA is made up of nitrogenous bases (adenine, guanine, cytosine, and thymine). DNA is usually a…

Q: A new virus variant has a protein with the following amino acid substitutions: S25K, L72F, T931,…

A: Amino acids are the molecules of carbon, hydrogen, nitrogen and oxygen that contain one carboxylic…

Q: 1. What is the sequence of the peptide that would result following translation with a ribosome?…

A: A codon is a three-nucleotide (tri-nucleotide) sequence of DNA or RNA that corresponds to a specific…

Q: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino…

A: Trancription It refers to the process of copying the genetic sequences of DNA into mRNA. Translation…

Q: "de 96 5 no

A: Answer :- The pH of the solution and the pKa values of the side chains of amino acids must be taken…

Q: I have a mixture of 4 proteins, whose sequences are shown below (note that each protein is a…

A: Proteins or peptides are composed of twenty standard amino acids attached together via peptide…

Q: CH, H H ОГТІ 0= II Т Н H-C- H₂C-N-C-C-O-P-OC-H CH, H H О 1 H-C-0 -Т Н 2 онннн Н II ТТГ Н Н Н Н Н Н Н…

A: A molecule is the smallest part of any substance that is made up of different atoms connected…

Q: First Second Letter Third Letter U A G Letter phenylalanine phenylalanine serine tyrosine cysteine U…

A: Gene is present in the DNA. It is made up of sequence of nucleotides. It encodes a protein.

Q: Second letter C UUU Phe UCU) UCC UGU UAU1 Tyr UAC S U UUC U UUA L UUG J Ser UGCCYS UAA Stop UGA Stop…

A: tRNA is an amino acid acceptor which carries the amino acid corresponding to the code present in the…

Q: Use the codon table shown above to help answer this question. Changing a UUG codon in mRNA to a UAG…

A: Proteins are made up of amino acids in a specific sequence and if mutation occur then the sequence…

Q: Genetics of Sickle Cell Anemia I Tools Add-ons Help Last edit was 3 minutes ago nal text Comfortaa В…

A: Sickle Cell anaemia is an autosome linked recessive trait that can be transmitted from parents to…

Q: Healthy Person: Galactose GALKI protein GALT protein Glucose GALE protein The three proteins work…

A: The term 'galactosemia' refers to disorders of galactose metabolism. It is a rare inherited…

Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…

A: The changes in the nucleotide sequence of DNA or RNA is known as mutation that can alter the…

Q: (3) If a DNA sequence is 5' TCC GGT CAT 3' what are the RNA and protein sequences that can be made…

A: Chargaff rule:The rule that in DNA there is always equality in quantity between the bases A and T…

Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…

A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…

Q: pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: 31

A: A phosphate group, a 5-carbon sugar ring (ribose/deoxyribose), and a nitrogenous base make up the…