What method might be used to determine the extent of binding of hemin to the 3 NEAT domains of Hbp2?
Q: Transferring of the protein bands from the SDS-PAGE gel to the PDVF membrane can be troublesome and…
A: Western blot: The technique is used for detecting specific proteins separated by electrophoresis by…
Q: What are the primary structures of TATA-binding protein (for ex. letter amino acids), What are the…
A: TATA-binding proteins (TBP) bind to Sequences on DNA called TATA boxes. TBP is a general…
Q: An important mechanism for generating diversity in immunoglobulin light chain V-region sequences is…
A: The mechanism of gene recombination that occurs during B cell formation allows for the creation of…
Q: What are two examples for which HCPCS codes should be reported?
A: Healthcare Common Procedure Coding System is abbreviated as HCPCS. It is an internationally accepted…
Q: what experiment can be used to confirm that agglutination was due to the binding of the lectins to…
A: Lectin is the collective name for all sugar-binding proteins. Lectins have one or more than one…
Q: The first 32 amino acids from the N terminus of the protein bovine angiogenin were determined by…
A: Protein Sequence First of all we need to understand where chymotrypsin act, which bond (peptide…
Q: The following question refers to the transcriptional control of the Gal7 locus in Saccramyces…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: How closely related are the amino acid sequences between SARS-Cov-2 and SARS-CoV? what does this…
A: SARS-CoV-2 and SARS-CoV are both coronaviruses that belong to the same family of viruses. They are…
Q: In BLOSUM62 matrix, a conserved Tryptophan position has score S(W,W) = 11, but a conserved Leucine…
A: BLOSUM is a block substitution matrix that is used to analyze and identify the best possible…
Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…
A: Introduction : The translated form of the DNA sequence is the amino acid sequence. The DNA sequence…
Q: High salt concentrations tend to cause protein aggregation. Suggest a way to identify proteins…
A: Introduction: Small, microscopic organisms are well-defined and usually described as known as…
Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…
A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…
Q: HS IP: FLAG-KDM3A SIA - WT + Lane Number: 1 2 3 S/D 4 5 6 Stat1 FLAG
A: KDM3A phosphorylation after 30 or 60 minutes of heat shock at 42°C (heat shock (HS) is generally…
Q: TGF-B Receptor I (RI) phosphorylation of Smad2/3 does all of the following EXCEPT activate Smad2/3…
A: The question digs into the complexities of the TGF-ẞ signaling pathway, centering on the…
Q: Which set of fragment ions is likely from the same population of precursors ions (parent peptide)…
A: ANS:- None of the described choices are likely.
Q: Suppose that you have decided to test whether the tyrosine residue of the spike protein is important…
A: Amino acids are the building blocks of protein. They are classified into different groups like…
Q: His-64 is an amino acid in myoglobin's herne-binding pocket. It is called the "distal histidine." A…
A: Myoglobin is a oxygen carrying protein similar to hemoglobin, present in muscle tissues that is…
Q: The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb.…
A: Because the gene contains introns (non-coding regions within the gene) that are removed during the…
Q: Which of the following epidermal growth factor (EGF) receptors cannot bind ligands but will form…
A: Epidermal growth factor (EGF) is a protein that plays a key role in the regulation of cell growth,…
Q: What type of motif/domain is present in the RPB2 subunit? What could be the function of this motif…
A: motif:Protein or nucleic acids are present in protein structure chain like biological molecules.A…
Q: The distal Histidine (His 64) in myoglobin is subjected to three different mutations, this is one of…
A: Both hemoglobin and myoglobin are oxygen binding proteins which are found in the red blood cells…
Q: Name two similarities and two differences between the cellular processes of importing protien into…
A: A plasma membrane allows various molecules that a cell requires to pass through. Transport proteins…
Q: For the genotypes and conditions (lactose present or absent) shown in the following Table 2, predict…
A: The prokaryotic gene regulation is known as operon system. In this condition the expression of a…
Q: The use of an SH2 domain binding inhibitor would be predicted to: O Decrease binding of SOS with RAS…
A: In the cellular response, the SRC homology (SH2) 2 domain is considered as the protein, which is…
Q: What are some limitations in the use of ASOs for exon-skipping therapies in Duchenne muscular…
A: Duchenne Muscular Dystrophy (DMD) is a muscular disease caused by mutations in the dystrophin gene…
Q: What transcritpion factor is produced in the Nieuwkoop center in reponse to nuclear beta-catenin?(…
A: Transcription factors are usually the protein that have the capacity to increase or decrease the…
Q: In Figure 12-4, certain mutations decrease the relativetranscription rate of the β-globin gene.…
A: A promoter is the region of DNA where transcription is initiated. It provides a site for binding of…
Q: Consider a mutant form of the lac repressor protein whose ΔGo for binding DNA differs from that of…
A: According to thermodynamics, every component of a system possesses free energy. Free energy of…
Q: Sort the following steps of GPCR signal propagation (you may not use all the steps): A)…
A: G protein coupled receptors are protein receptors that are found closely associated with G proteins…
Q: Comment on the difference in expression patterns between APETALA1 and CYCLIN1. How do the…
A: The genes are responsible for the expression of characters. There are two types of characters:…
Q: These sequences are derived from the middle region of the covid-19 spike protein. Which choice or…
A: trypsin digest is used to cleave the proteins in a sample downstream to every K (lysine) or R…
Q: RGS proteins accelerate the GAP activity of Gα subunits. What is the direct result of this GAP…
A: Introduction :- G proteins are signaling molecules that play a critical role in the transmission of…
Q: 1) In MALDI-TOF data, when performing peptide mass mapping search, a) The number of peptides…
A: Protein identification with the help of mass spectrometry (MS) is an major step in proteomic…
Q: What is one manner in which ERAD may identify misfolded proteins? Why is dislocation of these…
A: Proteins are the essential biomolecules that play a diverse role. Almost all cellular activities are…
Q: Would the following alterations to Src be oncogenic? Explain. (a) The deletion or inactivation of…
A: Src is a protooncogene.
Q: A particular type of anemia in humans, called b-thalassemia,results from a severe reduction or…
A: A disease is a state of unhealthiness of the physical body, mind and social interaction. A disease…
Q: Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I…
A: To identify the open reading frame (ORF) in a given DNA sequence, we need to locate the start codon…
Q: Yeast cells are eukaryotes, and they require a functional secretory pathway to grow and to maintain…
A: The signal recognition particle(SRP) is a very highly conserved and expressed ribonucleoprotein…
Q: The so-called kelch motif consists of a four-stranded β sheet, which forms what is known as a β…
A: Introduction Proteins are huge biomolecules and macromolecules that are made up of one or more long…
Q: You are studying how your Lys-Val-Thr tripep de interacts with another pep de, which places an Asp…
A: Eventhough all ionizable groups have their characteristic pKa value, the pKa value of an ionizable…
Q: Eukaryotic elongation factor 2 is inhibited by ADP ribosylation catalyzed by diphtheria toxin. What…
A: Introduction: The G protein is known for its huge part in numerous organic cycles. These proteins…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Using molecular cloning, a hybrid receptoer is produced that consists of the extracellular domain of the B-adrenergic receptor (B-AR) and the transmembrane and intracellular domains of the EGF receptor (EGFR). Question: What is the stoichiometric ratio of epinephrine to the hybrid receptor (B-AR-EGFR)? 1:1 O 1:4 O 1:2 2:1 O O Oa. Would you expect a cell to continue or to stopdividing at a nonpermissive high temperature if itis a temperature-sensitive Ras mutant whose protein product is fixed in the GTP-bound form atnonpermissive temperature?b. What would you expect if you had a temperaturesensitive mutant in which the Ras protein staysin the GDP-bound form at high temperature?When does the GTP head get attached to the 5' end and when does the Poly-A tail get attached to the 3' end? Also what is the significance of these additions?
- What type of experiment can be performed to confirm that the C-terminal KDEL tetrapeptide is both necessary and sufficient in ER localization? (Necessary meaning that without KDEL, ER retrieval would not occur, and sufficient meaning that with KDEL, we would definitely see its effect (ER retrieval would occur))A C-terminal KDEL tetrapeptide was identified by “sequence gazing” as a possiblesignal for keeping resident ER proteins in the ER. This idea is now described in yourtextbook as established fact. What types of experiments do you think were performedto confirm that KDEL serves as an ER localization signal?GTP-y-s serves as an analog of GTP that cannot be hydrolyzed any further. How would a Co-IP experiment differ between G- alpha & G-beta proteins in the presence of GTP-y-a and GDP?
- Consider the mechanism of the enzyme RNase: What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain. What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.Give typed explanation Which of the following effects is NOT true? If stripped Hb is treated with 2,3-BPG, the O2-binding curve for Hb will shift left. If stripped Hb is treated with 2,3-BPG and CO2, the O2-binding curve for Hb will mirror that of fully intact Hb. If stripped Hb is treated with CO2, the O2-binding curve for Hb will shift right. All of the listed effects are true.Searching the yeast Saccharomyces cerevisiae genome, researchers found approximately 4,000 DNA sites with a sequence which could potentially bind the yeast transcription factor GAL4. GAL4 activates the transcription of galactose genes. Yet there are only 10 GAL4-binding sites which control the genes necessary for galactose metabolism. The GAL4 binding sequence is CGGAT#AGAAGC*GCCG, where # is T, C or G, and * is C or T. In one chromatin immunoprecipitation experiment (ChIP), yeast growing on galactose were lysed, and subjected to cross-linking reagents which cross-linked transcription factors and activators to DNA. Next the DNA was sheared into small fragments, and antibodies to GAL4 were added. These antibodies coprecipitated the GAL4 and the DNA it was cross-linked to. The cross-linking was then chemically reversed, and the DNA was isolated, cloned into a library of plasmids and sequenced. Results showed that only 10 different DNA sequences had GAL4 bound. Since the…
- Mutation in the fibroblast growth factor receptor (FGFR) gene results in achondroplasia (dwarfism), which is a dominant condition caused by a single base substitution (GGG>AGG) that changes the amino acid glycine at position 480 to arginine (G480R) in the FGFR protein. FGFR is normally active when FGF binds to it, but the mutant FGFR is always on to stimulate signaling that inhibits excessive bone growth. How can gene therapy be used to treat achondroplasia? Select all that apply. RNAi that knocks down the mutant FGFR expression Adeno-associated viral (AAV) vector that carries the wild-type FGFR Retroviral vector that carries the wild-type FGFR CRISPR with the wild-type FGFR donor DNAThe amino acid at the β82 position is in the central cavity that binds 2,3-bisphosphoglycerate in the deoxygenated form of hemoglobin. How would the mutation of Lys to Asn affect the ability to bind to 2,3-BPG? a. It would have no effect. b. It would have decreased 2,3-BPG binding. c. It would have increased 2,3-BPG binding. d. It would have increased 2,3-BPG binding at least two fold.The diagram below shows a closeup of regulatory proteins binding to one of the UASG elements near the GAL7, GALI0, and GALI genes, which code for the protein products needed for yeast to use the sugar galactose. The red triangle symbolizes an "effector" molecule that binds to Gal80p. In this hypothesis (which has since been shown to be incorrect), what could be happening to Gal80p when it is bound to the effector molecule that causes it to change its position and uncover the Gal4p transcriptional activation domain. Hint: think about what effector molecules do upon binding to proteins such as the the Lac repressor protein or the CAP protein. Galactose absent, glucose absent Gal80p. _Activation domain Gal4p dimer -Binding domain UASG Galactose present, glucose absent Activation domain Gal80p- Binding domain UASG For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac).