What can you conclude by comparing potato A and potato D? 2. The liquid in the cavity of some potatoes came from where? 3. What is your conclusion about the experiment?
Q: A biochemist carefully measures the molarity of salt in 56. mL of photobacterium cell growth medium…
A: The initial volume of the cell growth medium is 56.0 ml, and the initial molarity of salt in the…
Q: Given: The used ocular objective while taking this image, has magnifying power of 6x The used…
A: Given : Stage micrometer used has graduation = 0.01mm Ten graduation on ocular micrometer coincides…
Q: Why are we using this materials and centrifuging at 15000 rpm? Lipid peroxidation experiment:…
A: The oxidative degeneration of lipids refers to lipid peroxidation, where the electrons from the…
Q: Which of the following was added to cell lysate to stabilize RNA molecules during the RNA…
A: Introduction RNA extraction is the purification of RNA from biological samples, It provides the…
Q: This is integral to obtaining the experimental data that lead to the development of this model…
A: Introduction ODE MODEL:- Ordinary differential equations or ODE models are used to model biological…
Q: A. Calculating true size from magnification. Indicate units for all measurements. Micrograph Number…
A: Actual Size refers to the size of the image divided by the Magnification. Actual size= ( Size of the…
Q: In which type of chromatography, solvents of increasing polarity are passed through a column of…
A: Chromatography is a separation technique that is used to separate components of a mixture based on…
Q: In the osmosis experiment, after the dialysis bags are filled with their sucrose solutions, they are…
A: Need to find the correct option from the given options.
Q: If these onion cells are placed in pure water, pure water is a solution.
A:
Q: What type of solution were the Hydrilla cells exposed to in the following wet mount slides? Refer to…
A: Solution is formed by mixing of solute with solvent.It is of two types :- 1 ) Hypertonic solution (…
Q: You prepared a 7x 10^5x dilution from your bacterial culture, plated 0.2 ml of it on a Petridish and…
A: A colony-forming unit (cfu) is a unit used in microbiology to estimate the number of viable bacteria…
Q: POTATO OSMOSIS (LABORATORY EXPERIMENTATION) MATERIALS: Small basin 2 medium size potatoes (fresh)…
A: Plant osmosis means the movement of water molecules through a semi-permeable membrane from a region…
Q: Place the following in the correct order in terms of steps taken, followed by the consideration…
A: DNA extraction consists of three simple steps: lysis, precipitation, and purification.
Q: (ER) fluids seen by naked eyes Material class: Material type [ non-smart/ smart / nano ] : Material…
A: A material is a substance that assumes a certain form under specified conditions. A material can be…
Q: During electrophoresis molecules are separated by three characteristics. What are they?
A: Electrophoresis is a technique commonly used in the lab to separate charged molecules, like DNA,…
Q: O 65 degrees Fahrenhelt O None of the above QUESTION 29 In the "DNA Extraction from Fruit"…
A: For your kind information, I am supposed to answer only the first question according to guidelines…
Q: 1a. what objective are you using to view the cell? (refer to picture)
A: A microscope is an instrument through which we can see the object that is too small to be seen by…
Q: EXPERIMENT : REMOVAL OF WATER FROM MICROBIAL CELLS USING FREEZE DRYING METHOD Objective To learn…
A: Introduction Freeze Drying Is A Technique That Includes Sucking A Completely Frozen Sample To Remove…
Q: A sample was placed on a chromatography column. Dichloromethane was used as the eluting solvent. All…
A: Column chromatography is a technique that allows chemists to separate substances based on their…
Q: You want to feed a new flask @: 2 x 105 cells/mL, 8 mL total per flask. Describe how you dilute your…
A: Viable or the live cells can be counted by the instrument called the hemocytometer. These live cells…
Q: Red blood cells are dropped in a solution of unknown concentration. Looking through the test tube,…
A:
Q: In which type of chromatography, solvents of increasing polarity are passed through a column of…
A: Chromatography is the most important technique for isolating and purifying biomolecules. It is a…
Q: Staining procedure Dye (Basic or acidic) Charge of the chromophore/ colored ion Charge of the target…
A: Staining methods are used to improve and enhance the sample contrast for it to be studied under a…
Q: What are the circumference of Egg A to C before and after the experimentation. 2. Which is the…
A: Osmosis is defined as a process in which there is a movement of solvent molecules from.a solution of…
Q: Typical microorganisms are on the scale of 1 micrometers. The typical human eye can see things as…
A: Microorganisms are also known as microbes, these are very tiny organisms present ubiquitously in…
Q: Gel-filtration chromatography separates molecules according to their size . Smaller molecules…
A: Gel-filtration chromatography is a type of separation technique that uses a gel as a medium through…
Q: In a chromatographic analysis, it was found out that distance travelled by the alcohol solvent is 5…
A: Chromatography is biochemical separation method for organic molecules or solutes of a compound…
Q: My disinfectant says it will kill 99.99% of bacteria. The directions say to achieve this kill rate I…
A: Sterilization is a physical or chemical process of eradicating harmful living microbes. These…
Q: If your sample material is large and difficult to work with as a whole (e.g. leaf, muscle tissue),…
A: Typically, a sample is the approximate value of an object that is intended to be identical and…
Q: EXPERIMENT : REMOVAL OF WATER FROM MICROBIAL CELLS USING FREEZE DRYING METHOD Objective To learn…
A: Freeze drying is a method that involves placing a completely frozen sample under a vacuum to remove…
Q: A student has a compound microscope equipped with 10X ocular lenses and 4X, 10X, 40X and 100X…
A: Introduction Magnification refers to enlarging something's apparent size rather than its true size.…
Q: Your slidebjs in focus on the microscope, but you do not see the specimen. 1. What are the…
A: Microscopy is the method to use a microscope for magnifying the minute objects. The technique is…
Q: Tables A & B. Ninhydrin and Biuret Reactions Samples TESTS Ninhydrin Biuret 1. Glycine 2. Casein 3.…
A: Protein is a nitrogenous organic macromolecule that is essential to human health. It is responsible…
Q: If a cell sample is placed in pure water, what is the concentration of the salt inside the cell?…
A: The water move inside the cell and outside the cell through the process of osmosis. If a cell is put…
Q: We performed two methods of electrophoresis this semester. List both electrophoresis methods, and…
A: Electrophoresis is the migration of charged particles under the influence of electric current.…
Q: In which type of chromatography lipids are carried up a silica gel coated pate by a rising solvent…
A: Answer: Introduction: Chromatography is separation analytical procedure used in separating a mixture…
Q: Assume that you are starting with a sample containing 6 billion active cells. Create a dilution plan…
A: Active cells 6 billion Aim is to achieve 30-300 colonies per plate Sample weight 500 mg or 0.5 gm
Q: Please answer the questions in the grey colored box provided in the image.
A: Percentage solutionTo find the percentage of a solution, (the ratio of the mass of the solute…
Q: You have two types of cells (animal cells and plant cells) that you will place in a variety of…
A: The tonicity of the solution present outside a cell (plant or animal) produces similar effects on…
Q: The culture you are working has a doubling time of 2 hours and a cell density of 3 x 106 cells per…
A: A serial dilution is a process of sequential dilution in order to decrease the density of cell…
Q: Hochman Practice: Complete Both distilled water and salt water affect cells because. Both distilled…
A: Osmosis is a process of movement of water or ions through a semipermeable membrane from the area of…
Q: Which of the following is INCORRECTLY paired? O Isoelectric focusing : Charge O Gel filtration…
A: The process of isolating one or more proteins from a complex mixture, which frequently includes…
Q: hemocytometer
A: INTRODUCTION : Experiment Aim is to determine the viable cell concentration . Before getting into…
Q: APPLICATION: How does the concept of osmosis and diffusion are applied in the preservation of food…
A: Introduction Turgor pressure: it is the pressure created by the water on the walls of the plasma…
Q: Why annealing, denaturation temperatures are different? Please answer at your own words.
A: Question: Why annealing, denaturation temperatures are different?
Q: The Shower from the Green Lagoon! Joey notices that his shower is covered in a strange green film.…
A: The independent variable in experimental analysis is any variable (parameter) whose outcome is…
Q: In sample preparation for electron microscopy, arrange the following steps in correct order A. Apply…
A: Electron microscopy is the technique of visualising the structure of tissues, cells and organelles…
Q: QUESTIONS: Give the factors the makes the size of the eggs. How can the egg represent a model of a…
A: Osmosis is the diffusion of molecules from higher to lower concentrations through a semipermeable…
Q: After trypsinization of cells in the flask and cell counting, you determined a concentration of 10…
A: The detachment of cells from the adhering substrate is essential for specific cellular…
POTATO OSMOSIS (LABORATORY EXPERIMENTATION)
MATERIALS:
- Small basin
- 2 medium size potatoes (fresh)
- Table salt
- Sugar
- Distilled water (Wilkins or H2Zero)
PROCEDURE:
A. POTATOES
- Cut the potatoes to half, making 4 pcs of potatoes
- Cook one of the half potatoes and set aside the 3 other potatoes
- Label the cooked potato as letter
B. MAKING A CAVITY
-
- Make a cavity of each half potato
- Label the raw potato as A B and C
- In potato A place salt on the cavity
- In potato B place sugar in the cavity
- Leave the potato C empty.
- Place sugar on the cavity of potato D
C. POTATO OSMOSIS
- Place distilled water in the basin and arranged the potatoes inside the basin. Leave it for 1hr. Observe after an hour. Do not mind the color of the potato.
QUESTIONS:
1. What can you conclude by comparing potato A and potato D?
2. The liquid in the cavity of some potatoes came from where?
3. What is your conclusion about the experiment?
Step by step
Solved in 4 steps
- option isoelectric focusinggel filtrationsalting outdifferential centrifugationEdman degradationion exchangedialysisIn disc diffusion studies, where will the lowest concentration of the tested chemical be in the agar plate? in the agar directly below the disc O in the agar halfway between the disc and the petri dish wall O in the agar furthest away from the disc the cehmical is equally distributed throughout the agarFile guft 1.yt Machine Cochise14ee7 Lane 0 Pmer. DTarPOPD mob Comment 17703 Spacing 15.06 Siga C 17A 4 G 2 Bases 0 an 2004 Gelstat ime123 219 20 30 60 70 NNACTCA TCTOGTGGA TTC CTA TCCTG AC A AG TGATGTG CAAAC TG GTAACTC TG AG GCAGATAAC CA G GG CA AA AAGGTG TATAAG 100 110 140 100 CAGA AG TC CGGA AA A TCA TT TAA 170 TAAA ACA AAGCCCTAACT TG GAAG AAGT TCA GTTTTACACA TCT TTA TA TG GAGAGAA 180 TAT TCTAT TA ATOTCCTGT TA TATT TG TCA TATTCA TA CAGT TGTCACAGTATATT TCAAAC CA AC TG TTTAAAA ACAAAC TO AAATAAA 210 230 240 260 270 AAATTTAAATACCCT TA TG TA AA ATAG GCT TC CC TG GTG GCTCAG GG GTAAAAA ACTCGC CCGC CA ACGCAG GAGATGTAGAT TTGATC CCT 300 310 340 350 410 430 440 GG GT TAG GA AG icCCTa GAGA AGGAAATGAAAAAC CACTCTAG TAT TCT Tac CTG GG AAATC CCA TGGACAG AG GAGCOTO GAG G Gc 490 500 SI0 530 TACAGTCCATGGGAGTCGCAA A AGAGT TG GACATG ACTAA ACA ACAACATATAAAATAACCT TACTC CATAATGTCAAACT TATOTCACAC S40 AAA ATGCAA AGT TCT TACATCTAT TAACTTTTATGOT TAAATATA ACCTAATGCACTOTTT TATACAGCA ACAACTACT TT TT TATTT TAAA…
- Which of the following equipments is used for plant cell or tissue culture? Lütfen birini seçin: O a. Hot Air Oven O b. All of these answers O c. Autoclave O d. Refrigerator О е. pH MeterReferences V8 ish (U.S.) Q Search f4 Review A AB I Text Predictions: On View Help BIU Part 2: 15 Cell components seen Illumination (ii) Complete the table comparing the light and electron microscopes. The table should fit on a single A4 sheet. Specimen preparation Image formation Magnification Tell me what you want to do Resolution Editor Suggestions! Showing H O E C t Αν Α f6 (iii) Explain the difference between magnification and resolution. E✓ ✓ f7 ) Light Microscope f8 19 E Ev Co A Electron Microscope f10 (A. C.1.2) 0 f11 V 12 Comments ✓ Dictate + 10 Rain CC scrollRefer to the following diagram: 100 ul 100 uL 100 pl 100 µL 100 pl 100 pL 100 pl Volume to transfer A B C D E F G 900 uL in each tube 10 102 10 10 10 10 10 Dilutions E.CoN culture Volume of the diluted sample plated 100 ul 100 μL 100 pL 100 ul Volume of the 10 ml 10 ml original sample plated 10 ml 10 ml Plate D Plate E Plate F Plate G Given that Plate D has too many colonies to count, and Plate G has no colonies at all as a result of serial dilution, draw out all four plates and demonstrate what they might look like (assuming serial dilution has been performed correctly). Based on your drawings, identify the number of CFU/ml for Plate E and Plate F. Show your calculations.
- MOLLISCH TEST You can use this as your reference : https://youtu.be/rKng5-ij6kQStudent Y is working with his microbiology experiment, the directions of the agar is to suspend 25g in 1000mL of distilled water, heat to boiling until completely dissolve. How much of the agar does he need to prepare for 18 petri dishes?Which of the following is the a-anomer? H но H Но H2C H ОН H2C- нн ОН со 4 1 2 1 Submit 3 -OH Н ОН -OH ОН Н there is no a-anomer ОН ОН Н Request Answer H Но НО Н H2C нн ОН 2 H2C ОН -OH 4 Н ОН н н H OH -О. ОН ОН Н ОН Н
- 1:07 < Вack Untitled 6 Brownian movement of bacteria: O a. Can be observed by the of soft agar technique O b. Can be observed by staining of Staphylococcus aureus Oc. Is common in Escherichia coli or Proteus vulgaris O d. Is common in Staphylococcus aureus O e. Can be observed at the edge of a microscope CLEAR MY CHOICENitrogen Content Assay Method II l is also known as? Micrometric Method Semimicro Method Macromethod DistillationA sample of Earth Alive Soil Activator was diluted by transferring 1 gram into a 9 ml dilution blank (tube A) and then serially diluted five (5) more times by transferring 1 ml of a previous dilution into a tube of 9 ml of sterile water. After making these serial dilutions, 2 ml samples were taken from tubes D, E, and F, added into empty petri dishes, and molten PCA was poured into each petri dish. Tubes A, B, and C were heated in a 80˚C water bath for 30 minutes, 2 ml samples of these tubes were added into empty petri dishes, and molten PCA was poured into each petri dish. These plates were allowed to solidify, and they were incubated at 35˚C for 48 hours. After the incubation period, you counted CFUs on all 6 plates. The results of your CFU counts are contained in table 1. Table 1. CFU counts for 3 plates from the heated dilutions (A-C) and the 3 plates from the non-heated dilutions (D-F) # CFUs Not heated Heated A -- 400 B -- 45 C -- 6 D 350 -- E 31 -- F 2 --…